Mutagenetix > Incidental Mutation

Incidental Mutation 'R4059:Agbl3'

314379

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

040970-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4059 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34846899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 833 (L833P)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: L838P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: L838P

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: L833P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: L833P

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Meta Mutation Damage Score

0.2130

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930453N24Rik	A	G	16: 64,766,458	V301A	probably benign	Het
Amph	T	C	13: 19,141,998	S633P	probably damaging	Het
Aspscr1	T	C	11: 120,686,679	V60A	probably benign	Het
Atp13a3	C	A	16: 30,354,246	C271F	possibly damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
BC051019	C	T	7: 109,717,995	W163*	probably null	Het
Capza1	T	C	3: 104,825,111	E245G	probably damaging	Het
Cd81	G	T	7: 143,065,293	C18F	probably damaging	Het
Cfap45	G	T	1: 172,538,489	R303L	probably benign	Het
Commd9	T	C	2: 101,895,154	V24A	possibly damaging	Het
Dennd4a	A	G	9: 64,911,892	N1742D	possibly damaging	Het
Dgat1	G	T	15: 76,504,171	A182D	possibly damaging	Het
Dlg4	T	C	11: 70,027,083	L64P	probably benign	Het
Dna2	A	G	10: 62,956,989	D261G	probably damaging	Het
Epb41l4b	C	T	4: 57,024,337		probably null	Het
Fam13c	T	C	10: 70,554,508	L533P	probably damaging	Het
Fjx1	T	C	2: 102,450,721	T290A	possibly damaging	Het
Hid1	C	T	11: 115,356,739	E278K	probably damaging	Het
Hsd3b7	T	C	7: 127,801,545	I57T	probably damaging	Het
Igfn1	A	G	1: 135,969,756	V1024A	probably benign	Het
Itgae	A	G	11: 73,112,134	K175E	probably benign	Het
Klhl32	T	C	4: 24,792,781	T14A	probably damaging	Het
Krt23	T	C	11: 99,485,788	T181A	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrrc36	A	G	8: 105,427,796	E33G	probably damaging	Het
Mettl13	G	T	1: 162,546,186	H165Q	probably damaging	Het
Mocos	G	A	18: 24,679,390	G447D	probably damaging	Het
Ngef	T	A	1: 87,486,231	K399N	probably damaging	Het
Ntrk1	A	G	3: 87,781,479	L589P	probably damaging	Het
Olfr1199	C	T	2: 88,756,451	V75I	probably benign	Het
Pcdha2	A	G	18: 36,939,882	S189G	probably benign	Het
Peg10	T	G	6: 4,756,427		probably benign	Het
Pkhd1l1	C	T	15: 44,550,760	H2808Y	probably benign	Het
Plekhg1	A	G	10: 3,957,087	D668G	probably damaging	Het
Ptcd2	A	G	13: 99,344,576	C32R	probably damaging	Het
Rgs8	A	G	1: 153,690,996	T98A	probably null	Het
Rhoh	G	A	5: 65,892,588	S67N	probably benign	Het
Rnd3	A	G	2: 51,148,748	F43L	probably damaging	Het
Runx1	A	G	16: 92,644,246	V225A	probably benign	Het
Runx1t1	T	C	4: 13,889,769	V566A	probably benign	Het
Sall2	A	G	14: 52,314,571	I387T	probably damaging	Het
Sec14l1	T	A	11: 117,149,198	V384D	possibly damaging	Het
Sh3rf3	T	C	10: 59,083,533	C491R	probably damaging	Het
Slc22a27	T	A	19: 7,879,608		probably benign	Het
Spire1	A	G	18: 67,545,713	S53P	probably damaging	Het
Tmco3	A	G	8: 13,320,848	R671G	probably benign	Het
Tmpo	A	G	10: 91,162,261	S555P	probably benign	Het
Tnip1	A	G	11: 54,911,569	S638P	probably benign	Het
Tspan8	C	T	10: 115,835,282	R115*	probably null	Het
Txnrd1	A	G	10: 82,885,280	E510G	probably benign	Het
Ucp3	T	C	7: 100,482,664	Y241H	probably damaging	Het
Vmn2r96	A	G	17: 18,598,077	I831V	probably benign	Het
Zan	T	C	5: 137,436,820	I2104V	unknown	Het
Zfp619	A	C	7: 39,535,399	R284S	probably benign	Het
Zfp715	T	C	7: 43,301,731	M48V	probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTATAAATATTTGTGGTTGCTCCC -3'
(R):5'- ACAAGCCGTGCTTCCTTATAAAAC -3'

Sequencing Primer
(F):5'- GTGGTTGCTCCCTAGAGTCAC -3'
(R):5'- GGTAGCTTAGAGGTAGAACATTTGC -3'

Posted On

2015-04-30