Incidental Mutation 'R4059:Ucp3'
ID314382
Institutional Source Beutler Lab
Gene Symbol Ucp3
Ensembl Gene ENSMUSG00000032942
Gene Nameuncoupling protein 3 (mitochondrial, proton carrier)
SynonymsUCP-3, Slc25a9
MMRRC Submission 040970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4059 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100472990-100486432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100482664 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 241 (Y241H)
Ref Sequence ENSEMBL: ENSMUSP00000102674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000107059]
Predicted Effect probably damaging
Transcript: ENSMUST00000032958
AA Change: Y241H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942
AA Change: Y241H

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 3.1e-20 PFAM
Pfam:Mito_carr 109 207 9.6e-26 PFAM
Pfam:Mito_carr 210 301 2.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107059
AA Change: Y241H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942
AA Change: Y241H

DomainStartEndE-ValueType
Pfam:Mito_carr 9 107 5.9e-22 PFAM
Pfam:Mito_carr 109 207 1.7e-27 PFAM
Pfam:Mito_carr 209 301 9.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133850
Meta Mutation Damage Score 0.2473 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutants exhibit a lack of superoxide-induced uncoupling in skeletal muscle mitochondria, accompanied by increased reactive oxygen species formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Agbl3 T C 6: 34,846,899 L833P probably damaging Het
Amph T C 13: 19,141,998 S633P probably damaging Het
Aspscr1 T C 11: 120,686,679 V60A probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
BC051019 C T 7: 109,717,995 W163* probably null Het
Capza1 T C 3: 104,825,111 E245G probably damaging Het
Cd81 G T 7: 143,065,293 C18F probably damaging Het
Cfap45 G T 1: 172,538,489 R303L probably benign Het
Commd9 T C 2: 101,895,154 V24A possibly damaging Het
Dennd4a A G 9: 64,911,892 N1742D possibly damaging Het
Dgat1 G T 15: 76,504,171 A182D possibly damaging Het
Dlg4 T C 11: 70,027,083 L64P probably benign Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Epb41l4b C T 4: 57,024,337 probably null Het
Fam13c T C 10: 70,554,508 L533P probably damaging Het
Fjx1 T C 2: 102,450,721 T290A possibly damaging Het
Hid1 C T 11: 115,356,739 E278K probably damaging Het
Hsd3b7 T C 7: 127,801,545 I57T probably damaging Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Itgae A G 11: 73,112,134 K175E probably benign Het
Klhl32 T C 4: 24,792,781 T14A probably damaging Het
Krt23 T C 11: 99,485,788 T181A probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc36 A G 8: 105,427,796 E33G probably damaging Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mocos G A 18: 24,679,390 G447D probably damaging Het
Ngef T A 1: 87,486,231 K399N probably damaging Het
Ntrk1 A G 3: 87,781,479 L589P probably damaging Het
Olfr1199 C T 2: 88,756,451 V75I probably benign Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Peg10 T G 6: 4,756,427 probably benign Het
Pkhd1l1 C T 15: 44,550,760 H2808Y probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Ptcd2 A G 13: 99,344,576 C32R probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhoh G A 5: 65,892,588 S67N probably benign Het
Rnd3 A G 2: 51,148,748 F43L probably damaging Het
Runx1 A G 16: 92,644,246 V225A probably benign Het
Runx1t1 T C 4: 13,889,769 V566A probably benign Het
Sall2 A G 14: 52,314,571 I387T probably damaging Het
Sec14l1 T A 11: 117,149,198 V384D possibly damaging Het
Sh3rf3 T C 10: 59,083,533 C491R probably damaging Het
Slc22a27 T A 19: 7,879,608 probably benign Het
Spire1 A G 18: 67,545,713 S53P probably damaging Het
Tmco3 A G 8: 13,320,848 R671G probably benign Het
Tmpo A G 10: 91,162,261 S555P probably benign Het
Tnip1 A G 11: 54,911,569 S638P probably benign Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Vmn2r96 A G 17: 18,598,077 I831V probably benign Het
Zan T C 5: 137,436,820 I2104V unknown Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Zfp715 T C 7: 43,301,731 M48V probably benign Het
Other mutations in Ucp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Ucp3 APN 7 100480559 missense probably damaging 1.00
IGL02883:Ucp3 APN 7 100480642 missense probably benign 0.00
IGL03137:Ucp3 APN 7 100482762 splice site probably benign
PIT4576001:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0532:Ucp3 UTSW 7 100481979 splice site probably benign
R0616:Ucp3 UTSW 7 100480161 missense probably benign 0.00
R0833:Ucp3 UTSW 7 100479541 nonsense probably null
R1739:Ucp3 UTSW 7 100482720 missense probably benign 0.01
R1939:Ucp3 UTSW 7 100480664 missense probably benign 0.00
R3861:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R3958:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R3959:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R5535:Ucp3 UTSW 7 100480666 missense probably benign 0.45
R6463:Ucp3 UTSW 7 100480269 missense probably benign 0.00
R6596:Ucp3 UTSW 7 100481933 missense probably benign 0.01
R7517:Ucp3 UTSW 7 100481882 missense probably damaging 1.00
R7693:Ucp3 UTSW 7 100482592 missense probably benign 0.00
Z1177:Ucp3 UTSW 7 100480592 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GACACAGTGAGGTCATCTGCAC -3'
(R):5'- TTTACCTAGCCTGGGCCTAC -3'

Sequencing Primer
(F):5'- GTGAGGTCATCTGCACCACAC -3'
(R):5'- GTGTGCCTACAATGCAGTACTCAG -3'
Posted On2015-04-30