Incidental Mutation 'R4059:Cd81'
ID314385
Institutional Source Beutler Lab
Gene Symbol Cd81
Ensembl Gene ENSMUSG00000037706
Gene NameCD81 antigen
SynonymsTspan28, Tapa-1, Tapa1
MMRRC Submission 040970-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R4059 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143052739-143067934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 143065293 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 18 (C18F)
Ref Sequence ENSEMBL: ENSMUSP00000146533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037941] [ENSMUST00000060433] [ENSMUST00000105920] [ENSMUST00000133410] [ENSMUST00000137856] [ENSMUST00000141954] [ENSMUST00000147995] [ENSMUST00000177841] [ENSMUST00000207448] [ENSMUST00000208779]
Predicted Effect probably damaging
Transcript: ENSMUST00000037941
AA Change: C89F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043768
Gene: ENSMUSG00000037706
AA Change: C89F

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 230 9.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060433
SMART Domains Protein: ENSMUSP00000056582
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 91 207 3.9e-43 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105920
SMART Domains Protein: ENSMUSP00000101540
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132303
Predicted Effect probably benign
Transcript: ENSMUST00000133410
SMART Domains Protein: ENSMUSP00000123499
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:TSSC4 159 266 5.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137856
SMART Domains Protein: ENSMUSP00000123353
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 209 1.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141954
AA Change: C18F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000147995
SMART Domains Protein: ENSMUSP00000122335
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 196 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148715
Predicted Effect probably benign
Transcript: ENSMUST00000177841
SMART Domains Protein: ENSMUSP00000137399
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 210 1.7e-34 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207448
AA Change: C18F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208278
Predicted Effect probably benign
Transcript: ENSMUST00000208779
Meta Mutation Damage Score 0.9615 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This protein appears to promote muscle cell fusion and support myotube maintenance. Also it may be involved in signal transduction. This gene is localized in the tumor-suppressor gene region and thus it is a candidate gene for malignancies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered antibody responses to specific antigens, reductions in peritoneal B-1 cell numbers and IL4 production, increased plasma IgA and IgM levels, and enlarged brains with more astrocytes and microglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Agbl3 T C 6: 34,846,899 L833P probably damaging Het
Amph T C 13: 19,141,998 S633P probably damaging Het
Aspscr1 T C 11: 120,686,679 V60A probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
BC051019 C T 7: 109,717,995 W163* probably null Het
Capza1 T C 3: 104,825,111 E245G probably damaging Het
Cfap45 G T 1: 172,538,489 R303L probably benign Het
Commd9 T C 2: 101,895,154 V24A possibly damaging Het
Dennd4a A G 9: 64,911,892 N1742D possibly damaging Het
Dgat1 G T 15: 76,504,171 A182D possibly damaging Het
Dlg4 T C 11: 70,027,083 L64P probably benign Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Epb41l4b C T 4: 57,024,337 probably null Het
Fam13c T C 10: 70,554,508 L533P probably damaging Het
Fjx1 T C 2: 102,450,721 T290A possibly damaging Het
Hid1 C T 11: 115,356,739 E278K probably damaging Het
Hsd3b7 T C 7: 127,801,545 I57T probably damaging Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Itgae A G 11: 73,112,134 K175E probably benign Het
Klhl32 T C 4: 24,792,781 T14A probably damaging Het
Krt23 T C 11: 99,485,788 T181A probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc36 A G 8: 105,427,796 E33G probably damaging Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mocos G A 18: 24,679,390 G447D probably damaging Het
Ngef T A 1: 87,486,231 K399N probably damaging Het
Ntrk1 A G 3: 87,781,479 L589P probably damaging Het
Olfr1199 C T 2: 88,756,451 V75I probably benign Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Peg10 T G 6: 4,756,427 probably benign Het
Pkhd1l1 C T 15: 44,550,760 H2808Y probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Ptcd2 A G 13: 99,344,576 C32R probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhoh G A 5: 65,892,588 S67N probably benign Het
Rnd3 A G 2: 51,148,748 F43L probably damaging Het
Runx1 A G 16: 92,644,246 V225A probably benign Het
Runx1t1 T C 4: 13,889,769 V566A probably benign Het
Sall2 A G 14: 52,314,571 I387T probably damaging Het
Sec14l1 T A 11: 117,149,198 V384D possibly damaging Het
Sh3rf3 T C 10: 59,083,533 C491R probably damaging Het
Slc22a27 T A 19: 7,879,608 probably benign Het
Spire1 A G 18: 67,545,713 S53P probably damaging Het
Tmco3 A G 8: 13,320,848 R671G probably benign Het
Tmpo A G 10: 91,162,261 S555P probably benign Het
Tnip1 A G 11: 54,911,569 S638P probably benign Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Ucp3 T C 7: 100,482,664 Y241H probably damaging Het
Vmn2r96 A G 17: 18,598,077 I831V probably benign Het
Zan T C 5: 137,436,820 I2104V unknown Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Zfp715 T C 7: 43,301,731 M48V probably benign Het
Other mutations in Cd81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cd81 APN 7 143067164 missense probably damaging 0.97
IGL02034:Cd81 APN 7 143066249 missense probably damaging 0.99
IGL02299:Cd81 APN 7 143065278 missense probably damaging 1.00
IGL03024:Cd81 APN 7 143067352 missense probably benign 0.04
R0893:Cd81 UTSW 7 143062505 missense possibly damaging 0.88
R1990:Cd81 UTSW 7 143067201 nonsense probably null
R1991:Cd81 UTSW 7 143067201 nonsense probably null
R2234:Cd81 UTSW 7 143066319 missense probably benign 0.02
R6172:Cd81 UTSW 7 143052954 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTAAACTCTGCCTGCTG -3'
(R):5'- TTCACCAGCAGCTAGTGTG -3'

Sequencing Primer
(F):5'- CTAAACTCTGCCTGCTGTGGTTG -3'
(R):5'- GAGACACCCTTCTGGAGTTTATGC -3'
Posted On2015-04-30