Incidental Mutation 'R4059:Tspan8'
ID314395
Institutional Source Beutler Lab
Gene Symbol Tspan8
Ensembl Gene ENSMUSG00000034127
Gene Nametetraspanin 8
SynonymsTm4sf3, E330007O21Rik
MMRRC Submission 040970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4059 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115816832-115849893 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 115835282 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 115 (R115*)
Ref Sequence ENSEMBL: ENSMUSP00000136645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035563] [ENSMUST00000080630] [ENSMUST00000179196] [ENSMUST00000217900]
Predicted Effect probably null
Transcript: ENSMUST00000035563
AA Change: R115*
SMART Domains Protein: ENSMUSP00000049243
Gene: ENSMUSG00000034127
AA Change: R115*

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 4.8e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000080630
AA Change: R115*
SMART Domains Protein: ENSMUSP00000079463
Gene: ENSMUSG00000034127
AA Change: R115*

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179196
AA Change: R115*
SMART Domains Protein: ENSMUSP00000136645
Gene: ENSMUSG00000034127
AA Change: R115*

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220081
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Agbl3 T C 6: 34,846,899 L833P probably damaging Het
Amph T C 13: 19,141,998 S633P probably damaging Het
Aspscr1 T C 11: 120,686,679 V60A probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
BC051019 C T 7: 109,717,995 W163* probably null Het
Capza1 T C 3: 104,825,111 E245G probably damaging Het
Cd81 G T 7: 143,065,293 C18F probably damaging Het
Cfap45 G T 1: 172,538,489 R303L probably benign Het
Commd9 T C 2: 101,895,154 V24A possibly damaging Het
Dennd4a A G 9: 64,911,892 N1742D possibly damaging Het
Dgat1 G T 15: 76,504,171 A182D possibly damaging Het
Dlg4 T C 11: 70,027,083 L64P probably benign Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Epb41l4b C T 4: 57,024,337 probably null Het
Fam13c T C 10: 70,554,508 L533P probably damaging Het
Fjx1 T C 2: 102,450,721 T290A possibly damaging Het
Hid1 C T 11: 115,356,739 E278K probably damaging Het
Hsd3b7 T C 7: 127,801,545 I57T probably damaging Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Itgae A G 11: 73,112,134 K175E probably benign Het
Klhl32 T C 4: 24,792,781 T14A probably damaging Het
Krt23 T C 11: 99,485,788 T181A probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc36 A G 8: 105,427,796 E33G probably damaging Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mocos G A 18: 24,679,390 G447D probably damaging Het
Ngef T A 1: 87,486,231 K399N probably damaging Het
Ntrk1 A G 3: 87,781,479 L589P probably damaging Het
Olfr1199 C T 2: 88,756,451 V75I probably benign Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Peg10 T G 6: 4,756,427 probably benign Het
Pkhd1l1 C T 15: 44,550,760 H2808Y probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Ptcd2 A G 13: 99,344,576 C32R probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhoh G A 5: 65,892,588 S67N probably benign Het
Rnd3 A G 2: 51,148,748 F43L probably damaging Het
Runx1 A G 16: 92,644,246 V225A probably benign Het
Runx1t1 T C 4: 13,889,769 V566A probably benign Het
Sall2 A G 14: 52,314,571 I387T probably damaging Het
Sec14l1 T A 11: 117,149,198 V384D possibly damaging Het
Sh3rf3 T C 10: 59,083,533 C491R probably damaging Het
Slc22a27 T A 19: 7,879,608 probably benign Het
Spire1 A G 18: 67,545,713 S53P probably damaging Het
Tmco3 A G 8: 13,320,848 R671G probably benign Het
Tmpo A G 10: 91,162,261 S555P probably benign Het
Tnip1 A G 11: 54,911,569 S638P probably benign Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Ucp3 T C 7: 100,482,664 Y241H probably damaging Het
Vmn2r96 A G 17: 18,598,077 I831V probably benign Het
Zan T C 5: 137,436,820 I2104V unknown Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Zfp715 T C 7: 43,301,731 M48V probably benign Het
Other mutations in Tspan8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Tspan8 APN 10 115844139 splice site probably benign
IGL01738:Tspan8 APN 10 115817665 splice site probably null
IGL01755:Tspan8 APN 10 115835298 missense probably damaging 1.00
IGL01993:Tspan8 APN 10 115840008 splice site probably benign
IGL02369:Tspan8 APN 10 115839877 missense probably benign 0.01
IGL02369:Tspan8 APN 10 115839878 missense probably benign 0.44
BB001:Tspan8 UTSW 10 115833324 critical splice donor site probably null
BB011:Tspan8 UTSW 10 115833324 critical splice donor site probably null
PIT4131001:Tspan8 UTSW 10 115817610 missense probably damaging 1.00
R1269:Tspan8 UTSW 10 115849382 missense probably damaging 0.97
R1693:Tspan8 UTSW 10 115844044 splice site probably benign
R1850:Tspan8 UTSW 10 115833225 missense probably damaging 0.98
R1975:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1976:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1977:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R4058:Tspan8 UTSW 10 115835282 nonsense probably null
R4999:Tspan8 UTSW 10 115817629 missense possibly damaging 0.91
R5879:Tspan8 UTSW 10 115833251 missense possibly damaging 0.89
R6290:Tspan8 UTSW 10 115827824 missense probably damaging 0.98
R6358:Tspan8 UTSW 10 115833227 missense probably benign 0.12
R6524:Tspan8 UTSW 10 115844079 missense probably benign
R7924:Tspan8 UTSW 10 115833324 critical splice donor site probably null
R8139:Tspan8 UTSW 10 115839897 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGCTGATTCTGATTCTGCAAG -3'
(R):5'- AGGGACTAGAAACTGTTCCAAATAC -3'

Sequencing Primer
(F):5'- GTTCGACAACTCTCACAGA -3'
(R):5'- TGGCTACAGCTCTAAAGGACCTG -3'
Posted On2015-04-30