Incidental Mutation 'R4059:4930453N24Rik'
ID314409
Institutional Source Beutler Lab
Gene Symbol 4930453N24Rik
Ensembl Gene ENSMUSG00000059920
Gene NameRIKEN cDNA 4930453N24 gene
Synonyms
MMRRC Submission 040970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4059 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location64751751-64771161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64766458 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 301 (V301A)
Ref Sequence ENSEMBL: ENSMUSP00000076255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076991]
Predicted Effect probably benign
Transcript: ENSMUST00000076991
AA Change: V301A

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076255
Gene: ENSMUSG00000059920
AA Change: V301A

DomainStartEndE-ValueType
Pfam:DUF4518 4 274 1.8e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162732
Meta Mutation Damage Score 0.2314 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous mutants show arrested eruption of incisors causing dentin formation to continue and occlude the pulp chamber. Mice also display small size, reduced ear pinna, and have abnormal coat color and patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T C 6: 34,846,899 L833P probably damaging Het
Amph T C 13: 19,141,998 S633P probably damaging Het
Aspscr1 T C 11: 120,686,679 V60A probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
BC051019 C T 7: 109,717,995 W163* probably null Het
Capza1 T C 3: 104,825,111 E245G probably damaging Het
Cd81 G T 7: 143,065,293 C18F probably damaging Het
Cfap45 G T 1: 172,538,489 R303L probably benign Het
Commd9 T C 2: 101,895,154 V24A possibly damaging Het
Dennd4a A G 9: 64,911,892 N1742D possibly damaging Het
Dgat1 G T 15: 76,504,171 A182D possibly damaging Het
Dlg4 T C 11: 70,027,083 L64P probably benign Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Epb41l4b C T 4: 57,024,337 probably null Het
Fam13c T C 10: 70,554,508 L533P probably damaging Het
Fjx1 T C 2: 102,450,721 T290A possibly damaging Het
Hid1 C T 11: 115,356,739 E278K probably damaging Het
Hsd3b7 T C 7: 127,801,545 I57T probably damaging Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Itgae A G 11: 73,112,134 K175E probably benign Het
Klhl32 T C 4: 24,792,781 T14A probably damaging Het
Krt23 T C 11: 99,485,788 T181A probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc36 A G 8: 105,427,796 E33G probably damaging Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mocos G A 18: 24,679,390 G447D probably damaging Het
Ngef T A 1: 87,486,231 K399N probably damaging Het
Ntrk1 A G 3: 87,781,479 L589P probably damaging Het
Olfr1199 C T 2: 88,756,451 V75I probably benign Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Peg10 T G 6: 4,756,427 probably benign Het
Pkhd1l1 C T 15: 44,550,760 H2808Y probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Ptcd2 A G 13: 99,344,576 C32R probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhoh G A 5: 65,892,588 S67N probably benign Het
Rnd3 A G 2: 51,148,748 F43L probably damaging Het
Runx1 A G 16: 92,644,246 V225A probably benign Het
Runx1t1 T C 4: 13,889,769 V566A probably benign Het
Sall2 A G 14: 52,314,571 I387T probably damaging Het
Sec14l1 T A 11: 117,149,198 V384D possibly damaging Het
Sh3rf3 T C 10: 59,083,533 C491R probably damaging Het
Slc22a27 T A 19: 7,879,608 probably benign Het
Spire1 A G 18: 67,545,713 S53P probably damaging Het
Tmco3 A G 8: 13,320,848 R671G probably benign Het
Tmpo A G 10: 91,162,261 S555P probably benign Het
Tnip1 A G 11: 54,911,569 S638P probably benign Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Ucp3 T C 7: 100,482,664 Y241H probably damaging Het
Vmn2r96 A G 17: 18,598,077 I831V probably benign Het
Zan T C 5: 137,436,820 I2104V unknown Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Zfp715 T C 7: 43,301,731 M48V probably benign Het
Other mutations in 4930453N24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03358:4930453N24Rik APN 16 64766546 missense possibly damaging 0.80
R0614:4930453N24Rik UTSW 16 64766614 missense probably damaging 1.00
R1729:4930453N24Rik UTSW 16 64769022 missense probably damaging 0.96
R1784:4930453N24Rik UTSW 16 64769022 missense probably damaging 0.96
R4058:4930453N24Rik UTSW 16 64766458 missense probably benign 0.43
R7099:4930453N24Rik UTSW 16 64770788 missense probably benign 0.36
R8298:4930453N24Rik UTSW 16 64766332 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGGCAGTGGCTTAGAGATAG -3'
(R):5'- CACCGAGGAAATTCTTGTTTGG -3'

Sequencing Primer
(F):5'- CAGTGGCTTAGAGATAGATGGTC -3'
(R):5'- GGGCATATTTGAGCAAATTTTTGGAC -3'
Posted On2015-04-30