Incidental Mutation 'R2145:Uxs1'
ID314427
Institutional Source Beutler Lab
Gene Symbol Uxs1
Ensembl Gene ENSMUSG00000057363
Gene NameUDP-glucuronate decarboxylase 1
Synonyms1600025I13Rik
MMRRC Submission 040148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2145 (G1)
Quality Score21
Status Validated
Chromosome1
Chromosomal Location43746966-43827800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43827623 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 29 (Y29C)
Ref Sequence ENSEMBL: ENSMUSP00000144114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076997] [ENSMUST00000126008] [ENSMUST00000128261] [ENSMUST00000136704] [ENSMUST00000139451] [ENSMUST00000153317]
Predicted Effect probably damaging
Transcript: ENSMUST00000076997
AA Change: Y29C

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076259
Gene: ENSMUSG00000057363
AA Change: Y29C

DomainStartEndE-ValueType
Pfam:UXS1_N 1 78 5.2e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126008
AA Change: Y29C

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119939
Gene: ENSMUSG00000057363
AA Change: Y29C

DomainStartEndE-ValueType
Pfam:UXS1_N 4 78 2.3e-40 PFAM
Pfam:RmlD_sub_bind 89 370 1.1e-11 PFAM
Pfam:Polysacc_synt_2 91 207 2.7e-6 PFAM
Pfam:Epimerase 91 324 9.8e-52 PFAM
Pfam:3Beta_HSD 92 305 1.8e-9 PFAM
Pfam:GDP_Man_Dehyd 92 387 1.3e-58 PFAM
Pfam:NAD_binding_4 129 297 4.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128261
AA Change: Y29C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116719
Gene: ENSMUSG00000057363
AA Change: Y29C

DomainStartEndE-ValueType
Pfam:UXS1_N 1 77 3.3e-38 PFAM
transmembrane domain 79 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136179
Predicted Effect unknown
Transcript: ENSMUST00000136704
AA Change: Y29C
Predicted Effect possibly damaging
Transcript: ENSMUST00000139451
AA Change: Y29C

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118468
Gene: ENSMUSG00000057363
AA Change: Y29C

DomainStartEndE-ValueType
Pfam:UXS1_N 1 83 4.4e-38 PFAM
Pfam:RmlD_sub_bind 94 254 2.6e-9 PFAM
Pfam:Polysacc_synt_2 96 211 1.2e-6 PFAM
Pfam:Epimerase 96 254 2.9e-27 PFAM
Pfam:3Beta_HSD 97 251 2.5e-9 PFAM
Pfam:NAD_binding_4 125 254 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153317
AA Change: Y29C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144114
Gene: ENSMUSG00000057363
AA Change: Y29C

DomainStartEndE-ValueType
Pfam:Epimerase 14 110 1.2e-13 PFAM
Pfam:GDP_Man_Dehyd 22 110 4.5e-18 PFAM
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme found in the perinuclear Golgi which catalyzes the synthesis of UDP-xylose used in glycosaminoglycan (GAG) synthesis on proteoglycans. The GAG chains are covalently attached to proteoglycans which participate in signaling pathways during development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele die prenatally. Heterozygous mice exhibit an increased mean serum IgG2a response to ovalbumin challenge when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,874 Y32C probably damaging Het
Abca15 A G 7: 120,354,478 N535S probably benign Het
Abcc6 A T 7: 45,998,741 L717Q probably benign Het
Abraxas2 C A 7: 132,883,061 Q278K probably benign Het
Acap2 A T 16: 31,105,524 D637E probably benign Het
AI661453 A G 17: 47,466,098 probably benign Het
Aoah A T 13: 20,840,096 E74V probably damaging Het
Appl1 A G 14: 26,949,619 L292S possibly damaging Het
Astl T A 2: 127,347,189 V166E probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bbs1 T G 19: 4,903,707 K143Q possibly damaging Het
Bbx T C 16: 50,274,544 probably benign Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
C1qtnf2 T G 11: 43,490,984 F178V probably damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Clcn7 A G 17: 25,144,451 I34V probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Des C A 1: 75,363,464 probably benign Het
Dgcr8 A T 16: 18,280,230 D432E probably benign Het
Dlgap5 G A 14: 47,395,923 R549* probably null Het
Dmxl2 T C 9: 54,415,910 T1397A probably damaging Het
Dnmt1 T A 9: 20,937,155 probably benign Het
Doxl2 A T 6: 48,976,695 D518V probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dtwd1 C A 2: 126,159,984 T208N probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dync1i2 T A 2: 71,214,563 probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Fmod T C 1: 134,040,518 Y99H probably benign Het
Fn1 A T 1: 71,606,004 V1552D probably damaging Het
Fnip2 A T 3: 79,500,432 S281T probably damaging Het
Glb1 A G 9: 114,464,165 H536R probably benign Het
Glis2 T A 16: 4,613,642 S344R possibly damaging Het
Gm1966 T A 7: 106,603,008 H343L possibly damaging Het
Gm4847 A T 1: 166,634,903 S339R probably benign Het
Gpr155 A G 2: 73,356,658 S44P probably benign Het
Gprin1 G A 13: 54,738,632 P610S probably damaging Het
H2-Ob A T 17: 34,242,580 M98L probably benign Het
Hist1h3e T C 13: 23,562,356 T4A probably benign Het
Hmcn2 T C 2: 31,333,931 probably benign Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Il13 T C 11: 53,632,524 T85A possibly damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Irgm2 T C 11: 58,220,529 S361P possibly damaging Het
Itga11 C T 9: 62,732,204 probably benign Het
Kalrn G T 16: 34,009,262 probably benign Het
Kcng1 C A 2: 168,269,032 G71C probably damaging Het
Kcnq5 T A 1: 21,505,349 D291V probably damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lhx6 C T 2: 36,087,466 V325I probably benign Het
Lipc A G 9: 70,934,535 I9T possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mast1 C A 8: 84,921,478 G458V probably damaging Het
Mga T C 2: 119,964,157 V2565A possibly damaging Het
Mkl2 T C 16: 13,412,586 I1045T probably damaging Het
Mpzl2 C G 9: 45,044,173 D127E probably benign Het
Myh3 T A 11: 67,091,056 C793S probably benign Het
Nomo1 T C 7: 46,066,504 L765P probably damaging Het
Nup210 A G 6: 91,028,876 I1335T possibly damaging Het
Olfr549 T C 7: 102,555,060 probably null Het
Oxr1 T A 15: 41,819,944 S254R probably damaging Het
Pan3 A G 5: 147,530,098 I592V possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pex2 T C 3: 5,561,590 E53G probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Phactr4 T C 4: 132,370,784 E391G probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Pkhd1l1 A T 15: 44,512,877 probably null Het
Pnlip A G 19: 58,676,444 S235G probably benign Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptprc T C 1: 138,073,681 Y780C probably damaging Het
Pxn T A 5: 115,552,756 probably benign Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rc3h1 G T 1: 160,930,257 K48N probably damaging Het
Rfwd3 T C 8: 111,282,613 I444V probably benign Het
Rictor C T 15: 6,765,107 R293C probably damaging Het
Rif1 T A 2: 52,111,400 I1622N possibly damaging Het
Rnf213 T C 11: 119,415,193 V609A probably benign Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Serac1 A T 17: 6,050,785 I448N probably damaging Het
Sh3kbp1 C A X: 159,824,496 T200K probably benign Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Socs7 T C 11: 97,373,124 F281L probably benign Het
Spta1 C T 1: 174,212,614 L1214F probably benign Het
Ssu72 A G 4: 155,705,443 E21G probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tmem130 C A 5: 144,743,785 V270L probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Tspyl2 A T X: 152,338,894 D572E probably benign Het
Unc45b G A 11: 82,917,754 R222H probably benign Het
Virma T A 4: 11,548,726 probably benign Het
Vmn1r202 C T 13: 22,501,783 G155S possibly damaging Het
Vmn2r24 T A 6: 123,779,013 F15I probably benign Het
Wdr64 A G 1: 175,767,095 T471A probably benign Het
Zfa-ps T A 10: 52,543,277 noncoding transcript Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Zfp934 T C 13: 62,517,834 D331G probably damaging Het
Zscan29 T C 2: 121,170,106 R7G probably damaging Het
Other mutations in Uxs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Uxs1 APN 1 43757013 missense probably benign 0.03
IGL02210:Uxs1 APN 1 43750286 missense possibly damaging 0.95
IGL03203:Uxs1 APN 1 43807344 intron probably benign
R0505:Uxs1 UTSW 1 43764886 splice site probably null
R1464:Uxs1 UTSW 1 43764916 nonsense probably null
R1464:Uxs1 UTSW 1 43764916 nonsense probably null
R1720:Uxs1 UTSW 1 43764921 missense probably damaging 1.00
R2079:Uxs1 UTSW 1 43764973 missense probably damaging 1.00
R2113:Uxs1 UTSW 1 43771773 missense probably damaging 1.00
R2124:Uxs1 UTSW 1 43774846 missense probably damaging 1.00
R4025:Uxs1 UTSW 1 43802616 intron probably benign
R4210:Uxs1 UTSW 1 43750238 missense possibly damaging 0.95
R4722:Uxs1 UTSW 1 43774846 missense probably damaging 1.00
R5321:Uxs1 UTSW 1 43805645 missense probably damaging 0.96
R5527:Uxs1 UTSW 1 43780080 missense probably damaging 1.00
R5854:Uxs1 UTSW 1 43780073 missense probably damaging 1.00
R6353:Uxs1 UTSW 1 43797250 missense probably damaging 0.99
R7205:Uxs1 UTSW 1 43816958 intron probably benign
R7235:Uxs1 UTSW 1 43764927 missense probably damaging 0.96
R7474:Uxs1 UTSW 1 43757024 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTATCCTACTTAACCAGCACCG -3'
(R):5'- AGGGATTACACTGCGCTTGC -3'

Sequencing Primer
(F):5'- AGTGTCTACAGCTCGGGGAAC -3'
(R):5'- AGCGCAGTGGTTTAGCC -3'
Posted On2015-05-06