Mutagenetix > Incidental Mutations

Incidental Mutation 'R2245:Brd1'

314432

Institutional Source

Beutler Lab

Gene Symbol

Brd1

Ensembl Gene

ENSMUSG00000022387

Gene Name

bromodomain containing 1

Synonyms

1110059H06Rik

MMRRC Submission

040245-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2245 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88687034-88734233 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 88689860 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109380] [ENSMUST00000109381]

Predicted Effect

probably null
Transcript: ENSMUST00000109380

SMART Domains

Protein: ENSMUSP00000105006
Gene: ENSMUSG00000022387

Domain	Start	End	E-Value	Type
Pfam:EPL1	46	196	3.3e-38	PFAM
PHD	216	262	3.17e-7	SMART
PHD	326	389	5.16e-7	SMART
low complexity region	415	436	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	532	551	N/A	INTRINSIC
BROMO	560	668	8.59e-39	SMART
coiled coil region	704	726	N/A	INTRINSIC
low complexity region	836	869	N/A	INTRINSIC
PWWP	927	1010	2.25e-39	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109381

SMART Domains

Protein: ENSMUSP00000105007
Gene: ENSMUSG00000022387

Domain	Start	End	E-Value	Type
Pfam:EPL1	47	196	3.9e-37	PFAM
PHD	216	262	3.17e-7	SMART
PHD	326	389	5.16e-7	SMART
low complexity region	415	436	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	532	551	N/A	INTRINSIC
BROMO	560	668	8.59e-39	SMART
coiled coil region	704	726	N/A	INTRINSIC
low complexity region	857	876	N/A	INTRINSIC
low complexity region	887	898	N/A	INTRINSIC
low complexity region	967	1000	N/A	INTRINSIC
PWWP	1058	1141	2.25e-39	SMART

Meta Mutation Damage Score

0.9579

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that localizes to the nucleus and can interact with DNA and histone tails. The encoded protein is a component of the MOZ/MORF acetyltransferase complex and can stimulate acetylation of histones H3 and H4, thereby potentially playing a role in gene activation. Variation in this gene is associated with schozophrenia and bipolar disorder in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal letahlity associated with severe growth retardation, abnormal lens, anemia, and impaired fetal hematopoiesis and erythropoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	A	G	7: 82,450,100	Q154R	probably damaging	Het
Alpk2	A	G	18: 65,305,163	L1520P	probably benign	Het
Ccdc158	A	G	5: 92,609,952		probably benign	Het
Cep350	C	A	1: 155,879,020	V1950F	probably benign	Het
Csnk1d	A	G	11: 120,972,403	I237T	probably damaging	Het
Ddah2	T	C	17: 35,061,585	L234P	probably damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Ephb1	A	C	9: 101,996,774		probably benign	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Myadml2	A	T	11: 120,647,830	F60I	probably damaging	Het
Myo15	T	C	11: 60,509,099	V2893A	probably damaging	Het
Ntn1	A	G	11: 68,385,294	V276A	probably benign	Het
Olfr1216	A	T	2: 89,013,149	I305K	probably benign	Het
Olfr1355	A	G	10: 78,879,931	Y253C	probably damaging	Het
Olfr745	T	A	14: 50,642,605	I102N	probably damaging	Het
Otof	T	C	5: 30,370,207	Y1962C	probably damaging	Het
Pcf11	T	C	7: 92,665,872		probably benign	Het
Polr2a	A	G	11: 69,735,183	S1676P	unknown	Het
Prpf40b	A	G	15: 99,305,166		probably benign	Het
Ptprh	T	C	7: 4,573,346	D305G	probably benign	Het
Rdh16f2	A	G	10: 127,876,276	K201E	probably damaging	Het
Slc19a3	T	C	1: 83,013,970	Y439C	possibly damaging	Het
Son	G	T	16: 91,647,960		probably null	Het
Specc1	T	C	11: 62,131,887	L710P	probably damaging	Het
Tex15	A	G	8: 33,571,496	D592G	possibly damaging	Het
Tmem237	A	T	1: 59,108,704	D209E	probably damaging	Het
Vmn2r106	T	C	17: 20,268,161	T659A	probably benign	Het
Vmn2r71	T	A	7: 85,624,180	I734N	probably damaging	Het
Wdr7	A	T	18: 63,924,909	I1270F	possibly damaging	Het

Other mutations in Brd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Brd1	APN	15	88730158	missense	probably benign	0.38
IGL00924:Brd1	APN	15	88729409	missense	possibly damaging	0.80
IGL01626:Brd1	APN	15	88700887	missense	probably damaging	1.00
IGL02569:Brd1	APN	15	88713929	missense	probably damaging	1.00
IGL02646:Brd1	APN	15	88700877	missense	probably damaging	1.00
IGL03130:Brd1	APN	15	88688374	missense	probably benign
IGL03343:Brd1	APN	15	88707251	missense	possibly damaging	0.89
spry	UTSW	15	88688355	missense	possibly damaging	0.47
R0089:Brd1	UTSW	15	88701198	missense	probably benign	0.06
R0112:Brd1	UTSW	15	88730383	missense	probably benign
R0165:Brd1	UTSW	15	88729777	missense	probably damaging	0.99
R0965:Brd1	UTSW	15	88717028	missense	probably damaging	1.00
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1534:Brd1	UTSW	15	88689663	missense	possibly damaging	0.68
R3611:Brd1	UTSW	15	88700944	missense	probably benign
R3751:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R3752:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R3753:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R3801:Brd1	UTSW	15	88717040	missense	probably damaging	1.00
R4956:Brd1	UTSW	15	88730113	missense	probably damaging	1.00
R5382:Brd1	UTSW	15	88729564	missense	probably damaging	1.00
R5546:Brd1	UTSW	15	88701122	missense	probably benign	0.00
R5659:Brd1	UTSW	15	88713381	missense	probably benign	0.14
R5730:Brd1	UTSW	15	88717045	missense	probably benign	0.05
R5773:Brd1	UTSW	15	88689549	missense	probably benign	0.14
R6224:Brd1	UTSW	15	88688355	missense	possibly damaging	0.47
R6371:Brd1	UTSW	15	88713998	missense	probably benign
R7096:Brd1	UTSW	15	88713935	missense	probably damaging	1.00
R7722:Brd1	UTSW	15	88729559	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGCATCTTGGGGTCAATAATC -3'
(R):5'- CTAGGAGACTGTGCTGAGTG -3'

Sequencing Primer
(F):5'- TGCTCCAGTGACTCACAGTAC -3'
(R):5'- AGACTGTGCTGAGTGTGTTAGC -3'

Posted On

2015-05-07