Incidental Mutation 'R2245:Brd1'
ID314432
Institutional Source Beutler Lab
Gene Symbol Brd1
Ensembl Gene ENSMUSG00000022387
Gene Namebromodomain containing 1
Synonyms1110059H06Rik
MMRRC Submission 040245-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2245 (G1)
Quality Score26
Status Validated
Chromosome15
Chromosomal Location88687034-88734233 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 88689860 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109380] [ENSMUST00000109381]
Predicted Effect probably null
Transcript: ENSMUST00000109380
SMART Domains Protein: ENSMUSP00000105006
Gene: ENSMUSG00000022387

DomainStartEndE-ValueType
Pfam:EPL1 46 196 3.3e-38 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 836 869 N/A INTRINSIC
PWWP 927 1010 2.25e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109381
SMART Domains Protein: ENSMUSP00000105007
Gene: ENSMUSG00000022387

DomainStartEndE-ValueType
Pfam:EPL1 47 196 3.9e-37 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 857 876 N/A INTRINSIC
low complexity region 887 898 N/A INTRINSIC
low complexity region 967 1000 N/A INTRINSIC
PWWP 1058 1141 2.25e-39 SMART
Meta Mutation Damage Score 0.9579 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that localizes to the nucleus and can interact with DNA and histone tails. The encoded protein is a component of the MOZ/MORF acetyltransferase complex and can stimulate acetylation of histones H3 and H4, thereby potentially playing a role in gene activation. Variation in this gene is associated with schozophrenia and bipolar disorder in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal letahlity associated with severe growth retardation, abnormal lens, anemia, and impaired fetal hematopoiesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 A G 7: 82,450,100 Q154R probably damaging Het
Alpk2 A G 18: 65,305,163 L1520P probably benign Het
Ccdc158 A G 5: 92,609,952 probably benign Het
Cep350 C A 1: 155,879,020 V1950F probably benign Het
Csnk1d A G 11: 120,972,403 I237T probably damaging Het
Ddah2 T C 17: 35,061,585 L234P probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ephb1 A C 9: 101,996,774 probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myadml2 A T 11: 120,647,830 F60I probably damaging Het
Myo15 T C 11: 60,509,099 V2893A probably damaging Het
Ntn1 A G 11: 68,385,294 V276A probably benign Het
Olfr1216 A T 2: 89,013,149 I305K probably benign Het
Olfr1355 A G 10: 78,879,931 Y253C probably damaging Het
Olfr745 T A 14: 50,642,605 I102N probably damaging Het
Otof T C 5: 30,370,207 Y1962C probably damaging Het
Pcf11 T C 7: 92,665,872 probably benign Het
Polr2a A G 11: 69,735,183 S1676P unknown Het
Prpf40b A G 15: 99,305,166 probably benign Het
Ptprh T C 7: 4,573,346 D305G probably benign Het
Rdh16f2 A G 10: 127,876,276 K201E probably damaging Het
Slc19a3 T C 1: 83,013,970 Y439C possibly damaging Het
Son G T 16: 91,647,960 probably null Het
Specc1 T C 11: 62,131,887 L710P probably damaging Het
Tex15 A G 8: 33,571,496 D592G possibly damaging Het
Tmem237 A T 1: 59,108,704 D209E probably damaging Het
Vmn2r106 T C 17: 20,268,161 T659A probably benign Het
Vmn2r71 T A 7: 85,624,180 I734N probably damaging Het
Wdr7 A T 18: 63,924,909 I1270F possibly damaging Het
Other mutations in Brd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd1 APN 15 88730158 missense probably benign 0.38
IGL00924:Brd1 APN 15 88729409 missense possibly damaging 0.80
IGL01626:Brd1 APN 15 88700887 missense probably damaging 1.00
IGL02569:Brd1 APN 15 88713929 missense probably damaging 1.00
IGL02646:Brd1 APN 15 88700877 missense probably damaging 1.00
IGL03130:Brd1 APN 15 88688374 missense probably benign
IGL03343:Brd1 APN 15 88707251 missense possibly damaging 0.89
spry UTSW 15 88688355 missense possibly damaging 0.47
R0089:Brd1 UTSW 15 88701198 missense probably benign 0.06
R0112:Brd1 UTSW 15 88730383 missense probably benign
R0165:Brd1 UTSW 15 88729777 missense probably damaging 0.99
R0965:Brd1 UTSW 15 88717028 missense probably damaging 1.00
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1534:Brd1 UTSW 15 88689663 missense possibly damaging 0.68
R3611:Brd1 UTSW 15 88700944 missense probably benign
R3751:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3752:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3753:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3801:Brd1 UTSW 15 88717040 missense probably damaging 1.00
R4956:Brd1 UTSW 15 88730113 missense probably damaging 1.00
R5382:Brd1 UTSW 15 88729564 missense probably damaging 1.00
R5546:Brd1 UTSW 15 88701122 missense probably benign 0.00
R5659:Brd1 UTSW 15 88713381 missense probably benign 0.14
R5730:Brd1 UTSW 15 88717045 missense probably benign 0.05
R5773:Brd1 UTSW 15 88689549 missense probably benign 0.14
R6224:Brd1 UTSW 15 88688355 missense possibly damaging 0.47
R6371:Brd1 UTSW 15 88713998 missense probably benign
R7096:Brd1 UTSW 15 88713935 missense probably damaging 1.00
R7722:Brd1 UTSW 15 88729559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCATCTTGGGGTCAATAATC -3'
(R):5'- CTAGGAGACTGTGCTGAGTG -3'

Sequencing Primer
(F):5'- TGCTCCAGTGACTCACAGTAC -3'
(R):5'- AGACTGTGCTGAGTGTGTTAGC -3'
Posted On2015-05-07