Incidental Mutation 'R4112:Cdh17'
ID314449
Institutional Source Beutler Lab
Gene Symbol Cdh17
Ensembl Gene ENSMUSG00000028217
Gene Namecadherin 17
SynonymsBILL-cadherin, LI-cadherin, HPT-1
MMRRC Submission 040989-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4112 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11758147-11817895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11814628 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 728 (S728P)
Ref Sequence ENSEMBL: ENSMUSP00000029871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029871] [ENSMUST00000108303]
Predicted Effect probably damaging
Transcript: ENSMUST00000029871
AA Change: S728P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029871
Gene: ENSMUSG00000028217
AA Change: S728P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Blast:CA 687 771 5e-39 BLAST
transmembrane domain 784 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108303
SMART Domains Protein: ENSMUSP00000103938
Gene: ENSMUSG00000028217

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Meta Mutation Damage Score 0.2539 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit impaired B lymphocyte development and impaired IgG1 and IgG3 antibody response to T-independent antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
5830411N06Rik G T 7: 140,298,368 G1003* probably null Het
Aamp A G 1: 74,281,227 probably benign Het
Abcb4 A G 5: 8,936,783 probably null Het
Adam6b T A 12: 113,489,636 F24L possibly damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Angpt2 T A 8: 18,699,123 Q326L probably damaging Het
Armc9 T A 1: 86,188,939 I327N possibly damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
Ccdc162 T A 10: 41,656,328 E450V possibly damaging Het
Ccdc7b G T 8: 129,085,227 probably benign Het
Chia1 T C 3: 106,128,528 L168P probably damaging Het
Cnot1 A C 8: 95,773,618 L111V probably damaging Het
Col14a1 A T 15: 55,363,559 N235I unknown Het
Col2a1 A C 15: 97,983,701 L787R probably benign Het
Cyp3a25 A T 5: 146,003,031 D55E probably benign Het
Dennd6a A T 14: 26,628,518 probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Gemin4 T A 11: 76,212,819 E372V probably damaging Het
Glyr1 T C 16: 5,018,486 K500E possibly damaging Het
Gm10271 A T 10: 116,968,038 probably benign Het
Gm20775 A T Y: 10,641,878 noncoding transcript Het
Gm5578 A G 6: 112,606,505 noncoding transcript Het
Gxylt2 A G 6: 100,783,206 N234S probably damaging Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Klf17 A G 4: 117,760,701 V153A possibly damaging Het
L3mbtl2 T C 15: 81,681,969 V331A possibly damaging Het
Med1 A T 11: 98,180,087 V110E probably damaging Het
Nsmaf A C 4: 6,417,188 Y535* probably null Het
Pcdh10 G A 3: 45,381,620 V790M probably damaging Het
Phlpp1 A G 1: 106,364,338 T976A probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprk T A 10: 28,475,288 probably null Het
Rbm5 A T 9: 107,765,597 D79E probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rnd3 T A 2: 51,148,230 T78S possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc10a2 C T 8: 5,105,135 D17N probably benign Het
Snap23 C T 2: 120,584,375 probably benign Het
Sptb T A 12: 76,597,779 T2098S probably damaging Het
Src T A 2: 157,463,026 L165H probably damaging Het
Srr G T 11: 74,913,072 Q20K probably benign Het
Stt3b A T 9: 115,266,138 F275Y probably damaging Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tmem80 A G 7: 141,333,779 probably benign Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Ttc24 T A 3: 88,074,639 D40V probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp3 T A 11: 70,771,507 S97R probably benign Het
Other mutations in Cdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Cdh17 APN 4 11797780 splice site probably benign
IGL00823:Cdh17 APN 4 11783412 missense possibly damaging 0.78
IGL00824:Cdh17 APN 4 11784675 missense probably benign 0.00
IGL01572:Cdh17 APN 4 11784621 splice site probably benign
IGL01602:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01605:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01759:Cdh17 APN 4 11771262 splice site probably benign
IGL02065:Cdh17 APN 4 11771373 splice site probably benign
IGL02448:Cdh17 APN 4 11784680 missense probably benign
IGL02869:Cdh17 APN 4 11814908 missense probably benign 0.00
IGL03088:Cdh17 APN 4 11810473 missense probably damaging 1.00
Disruptive UTSW 4 11784654 missense probably damaging 1.00
R0054:Cdh17 UTSW 4 11785186 missense possibly damaging 0.59
R0081:Cdh17 UTSW 4 11785280 splice site probably benign
R0101:Cdh17 UTSW 4 11771341 missense probably benign 0.00
R0432:Cdh17 UTSW 4 11771273 nonsense probably null
R0718:Cdh17 UTSW 4 11810451 missense possibly damaging 0.68
R0946:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1076:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1217:Cdh17 UTSW 4 11799676 missense probably benign 0.04
R2060:Cdh17 UTSW 4 11803982 missense probably benign 0.03
R3808:Cdh17 UTSW 4 11795671 missense probably damaging 0.99
R3850:Cdh17 UTSW 4 11785201 missense probably damaging 1.00
R4111:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4583:Cdh17 UTSW 4 11810466 missense probably benign 0.00
R4683:Cdh17 UTSW 4 11817036 missense possibly damaging 0.78
R4797:Cdh17 UTSW 4 11810390 missense probably benign 0.00
R5050:Cdh17 UTSW 4 11784654 missense probably damaging 1.00
R5071:Cdh17 UTSW 4 11810325 missense probably damaging 0.98
R5569:Cdh17 UTSW 4 11816990 missense probably damaging 0.96
R5790:Cdh17 UTSW 4 11814945 unclassified probably null
R6077:Cdh17 UTSW 4 11803969 missense probably benign 0.22
R6581:Cdh17 UTSW 4 11799615 missense probably damaging 1.00
R7274:Cdh17 UTSW 4 11783174 nonsense probably null
R7647:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
R7649:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
X0067:Cdh17 UTSW 4 11785224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGTTAAAAGGATGTGTTAGCCC -3'
(R):5'- GAACAGGGCTCCATAGATTACG -3'

Sequencing Primer
(F):5'- TTTTGGTAAGAGACATGGAA -3'
(R):5'- GGGCTCCATAGATTACGTTTTTAAG -3'
Posted On2015-05-14