Incidental Mutation 'R4112:5830411N06Rik'
ID 314459
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
MMRRC Submission 040989-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4112 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 140298368 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 1003 (G1003*)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059882
SMART Domains Protein: ENSMUSP00000061346
Gene: ENSMUSG00000054672

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093984
AA Change: G887*
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: G887*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164583
AA Change: G1003*
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: G1003*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211749
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aamp A G 1: 74,281,227 probably benign Het
Abcb4 A G 5: 8,936,783 probably null Het
Adam6b T A 12: 113,489,636 F24L possibly damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Angpt2 T A 8: 18,699,123 Q326L probably damaging Het
Armc9 T A 1: 86,188,939 I327N possibly damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
Ccdc162 T A 10: 41,656,328 E450V possibly damaging Het
Ccdc7b G T 8: 129,085,227 probably benign Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Chia1 T C 3: 106,128,528 L168P probably damaging Het
Cnot1 A C 8: 95,773,618 L111V probably damaging Het
Col14a1 A T 15: 55,363,559 N235I unknown Het
Col2a1 A C 15: 97,983,701 L787R probably benign Het
Cyp3a25 A T 5: 146,003,031 D55E probably benign Het
Dennd6a A T 14: 26,628,518 probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Gemin4 T A 11: 76,212,819 E372V probably damaging Het
Glyr1 T C 16: 5,018,486 K500E possibly damaging Het
Gm10271 A T 10: 116,968,038 probably benign Het
Gm20775 A T Y: 10,641,878 noncoding transcript Het
Gm5578 A G 6: 112,606,505 noncoding transcript Het
Gxylt2 A G 6: 100,783,206 N234S probably damaging Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Klf17 A G 4: 117,760,701 V153A possibly damaging Het
L3mbtl2 T C 15: 81,681,969 V331A possibly damaging Het
Med1 A T 11: 98,180,087 V110E probably damaging Het
Nsmaf A C 4: 6,417,188 Y535* probably null Het
Pcdh10 G A 3: 45,381,620 V790M probably damaging Het
Phlpp1 A G 1: 106,364,338 T976A probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprk T A 10: 28,475,288 probably null Het
Rbm5 A T 9: 107,765,597 D79E probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rnd3 T A 2: 51,148,230 T78S possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc10a2 C T 8: 5,105,135 D17N probably benign Het
Snap23 C T 2: 120,584,375 probably benign Het
Sptb T A 12: 76,597,779 T2098S probably damaging Het
Src T A 2: 157,463,026 L165H probably damaging Het
Srr G T 11: 74,913,072 Q20K probably benign Het
Stt3b A T 9: 115,266,138 F275Y probably damaging Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tmem80 A G 7: 141,333,779 probably benign Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Ttc24 T A 3: 88,074,639 D40V probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp3 T A 11: 70,771,507 S97R probably benign Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGACTCCAGTGTTCAGG -3'
(R):5'- GCTCATGACCGGGTAGTTTG -3'

Sequencing Primer
(F):5'- GACTCCAGTGTTCAGGGTTCCAC -3'
(R):5'- GTTTTCCCATTCAGCAGGCACAG -3'
Posted On 2015-05-14