Mutagenetix > Incidental Mutation

Incidental Mutation 'R4112:Cnot1'

314464

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040989-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4112 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 95773618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 111 (L111V)

Ref Sequence

ENSEMBL: ENSMUSP00000148574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: L111V

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: L111V

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: L111V

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: L111V

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: L109V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

probably damaging
Transcript: ENSMUST00000212323
AA Change: L111V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212863

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: L111V

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.0740

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.3%

Validation Efficiency

97% (56/58)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
5830411N06Rik	G	T	7: 140,298,368	G1003*	probably null	Het
Aamp	A	G	1: 74,281,227		probably benign	Het
Abcb4	A	G	5: 8,936,783		probably null	Het
Adam6b	T	A	12: 113,489,636	F24L	possibly damaging	Het
Alms1	G	A	6: 85,620,888	V1368I	probably benign	Het
Angpt2	T	A	8: 18,699,123	Q326L	probably damaging	Het
Armc9	T	A	1: 86,188,939	I327N	possibly damaging	Het
Bace2	A	G	16: 97,436,656	T436A	probably benign	Het
Ccdc162	T	A	10: 41,656,328	E450V	possibly damaging	Het
Ccdc7b	G	T	8: 129,085,227		probably benign	Het
Cdh17	T	C	4: 11,814,628	S728P	probably damaging	Het
Chia1	T	C	3: 106,128,528	L168P	probably damaging	Het
Col14a1	A	T	15: 55,363,559	N235I	unknown	Het
Col2a1	A	C	15: 97,983,701	L787R	probably benign	Het
Cyp3a25	A	T	5: 146,003,031	D55E	probably benign	Het
Dennd6a	A	T	14: 26,628,518		probably benign	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Etfbkmt	T	C	6: 149,144,591		probably benign	Het
Etfrf1	T	C	6: 145,215,372	Y23H	probably damaging	Het
Gemin4	T	A	11: 76,212,819	E372V	probably damaging	Het
Glyr1	T	C	16: 5,018,486	K500E	possibly damaging	Het
Gm10271	A	T	10: 116,968,038		probably benign	Het
Gm20775	A	T	Y: 10,641,878		noncoding transcript	Het
Gm5578	A	G	6: 112,606,505		noncoding transcript	Het
Gxylt2	A	G	6: 100,783,206	N234S	probably damaging	Het
Kcna6	G	C	6: 126,739,774	R51G	probably damaging	Het
Klf17	A	G	4: 117,760,701	V153A	possibly damaging	Het
L3mbtl2	T	C	15: 81,681,969	V331A	possibly damaging	Het
Med1	A	T	11: 98,180,087	V110E	probably damaging	Het
Nsmaf	A	C	4: 6,417,188	Y535*	probably null	Het
Pcdh10	G	A	3: 45,381,620	V790M	probably damaging	Het
Phlpp1	A	G	1: 106,364,338	T976A	probably damaging	Het
Prelid3a	T	C	18: 67,472,897	Y25H	probably damaging	Het
Ptprk	T	A	10: 28,475,288		probably null	Het
Rbm5	A	T	9: 107,765,597	D79E	probably damaging	Het
Rhox3f	G	T	X: 37,582,019	E140*	probably null	Het
Rnd3	T	A	2: 51,148,230	T78S	possibly damaging	Het
Sgca	T	C	11: 94,972,570	T27A	possibly damaging	Het
Slc10a2	C	T	8: 5,105,135	D17N	probably benign	Het
Snap23	C	T	2: 120,584,375		probably benign	Het
Sptb	T	A	12: 76,597,779	T2098S	probably damaging	Het
Src	T	A	2: 157,463,026	L165H	probably damaging	Het
Srr	G	T	11: 74,913,072	Q20K	probably benign	Het
Stt3b	A	T	9: 115,266,138	F275Y	probably damaging	Het
Sucnr1	C	G	3: 60,086,794	R248G	probably damaging	Het
Thsd7b	A	T	1: 130,116,619	D1112V	probably benign	Het
Tmem80	A	G	7: 141,333,779		probably benign	Het
Top2a	C	A	11: 99,022,960	K18N	probably damaging	Het
Ttc24	T	A	3: 88,074,639	D40V	probably damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Zfp3	T	A	11: 70,771,507	S97R	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- CTGAGATCTGGGCTAGAAGAATTC -3'
(R):5'- TTGCTTGTAGTGACCCAGAGTC -3'

Sequencing Primer
(F):5'- TCTGGGCTAGAAGAATTCAAAAGG -3'
(R):5'- GGTCCTGAGTTCAAATCCCAG -3'

Posted On

2015-05-14