Incidental Mutation 'R4112:Ccdc162'
ID314469
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
MMRRC Submission 040989-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4112 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41656328 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 450 (E450V)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000189488] [ENSMUST00000190522]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189488
AA Change: E450V

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: E450V

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190522
AA Change: E450V

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140852
Gene: ENSMUSG00000100855
AA Change: E450V

DomainStartEndE-ValueType
Pfam:DUF4549 2 145 7.9e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190522
AA Change: E450V

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
5830411N06Rik G T 7: 140,298,368 G1003* probably null Het
Aamp A G 1: 74,281,227 probably benign Het
Abcb4 A G 5: 8,936,783 probably null Het
Adam6b T A 12: 113,489,636 F24L possibly damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Angpt2 T A 8: 18,699,123 Q326L probably damaging Het
Armc9 T A 1: 86,188,939 I327N possibly damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
Ccdc7b G T 8: 129,085,227 probably benign Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Chia1 T C 3: 106,128,528 L168P probably damaging Het
Cnot1 A C 8: 95,773,618 L111V probably damaging Het
Col14a1 A T 15: 55,363,559 N235I unknown Het
Col2a1 A C 15: 97,983,701 L787R probably benign Het
Cyp3a25 A T 5: 146,003,031 D55E probably benign Het
Dennd6a A T 14: 26,628,518 probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Gemin4 T A 11: 76,212,819 E372V probably damaging Het
Glyr1 T C 16: 5,018,486 K500E possibly damaging Het
Gm10271 A T 10: 116,968,038 probably benign Het
Gm20775 A T Y: 10,641,878 noncoding transcript Het
Gm5578 A G 6: 112,606,505 noncoding transcript Het
Gxylt2 A G 6: 100,783,206 N234S probably damaging Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Klf17 A G 4: 117,760,701 V153A possibly damaging Het
L3mbtl2 T C 15: 81,681,969 V331A possibly damaging Het
Med1 A T 11: 98,180,087 V110E probably damaging Het
Nsmaf A C 4: 6,417,188 Y535* probably null Het
Pcdh10 G A 3: 45,381,620 V790M probably damaging Het
Phlpp1 A G 1: 106,364,338 T976A probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprk T A 10: 28,475,288 probably null Het
Rbm5 A T 9: 107,765,597 D79E probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rnd3 T A 2: 51,148,230 T78S possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc10a2 C T 8: 5,105,135 D17N probably benign Het
Snap23 C T 2: 120,584,375 probably benign Het
Sptb T A 12: 76,597,779 T2098S probably damaging Het
Src T A 2: 157,463,026 L165H probably damaging Het
Srr G T 11: 74,913,072 Q20K probably benign Het
Stt3b A T 9: 115,266,138 F275Y probably damaging Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tmem80 A G 7: 141,333,779 probably benign Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Ttc24 T A 3: 88,074,639 D40V probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp3 T A 11: 70,771,507 S97R probably benign Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
R7712:Ccdc162 UTSW 10 41627227 missense possibly damaging 0.56
R7726:Ccdc162 UTSW 10 41553075 missense probably benign 0.00
R7754:Ccdc162 UTSW 10 41587375 missense probably damaging 1.00
R7764:Ccdc162 UTSW 10 41690113 missense possibly damaging 0.95
R8053:Ccdc162 UTSW 10 41644581 missense probably benign
R8088:Ccdc162 UTSW 10 41623414 missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41612868 missense probably benign 0.02
R8097:Ccdc162 UTSW 10 41634119 missense probably benign 0.03
Z1176:Ccdc162 UTSW 10 41553131 missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41605108 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41654997 missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41690092 missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41683195 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTTCGAGATCACATGTAAGCTAC -3'
(R):5'- GCAGCTGCTGTATAAAAGCTGTC -3'

Sequencing Primer
(F):5'- TGTAAGCTACACACTCCTCAGC -3'
(R):5'- TTCTATGATGACCTGTGATTT -3'
Posted On2015-05-14