Incidental Mutation 'R0389:Golga1'
ID 31447
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Name golgin A1
Synonyms Golgi97, golgin-97, 0710001G09Rik, awag, 2210418B03Rik
MMRRC Submission 038595-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R0389 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 38906167-38955553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38908453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 749 (S749T)
Ref Sequence ENSEMBL: ENSMUSP00000139001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000090993] [ENSMUST00000112850] [ENSMUST00000112862] [ENSMUST00000184996]
AlphaFold Q9CW79
Predicted Effect probably damaging
Transcript: ENSMUST00000039165
AA Change: S749T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: S749T

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090993
SMART Domains Protein: ENSMUSP00000088516
Gene: ENSMUSG00000026755

DomainStartEndE-ValueType
Pfam:P16-Arc 8 153 4.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112850
AA Change: S724T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: S724T

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112862
SMART Domains Protein: ENSMUSP00000108483
Gene: ENSMUSG00000026755

DomainStartEndE-ValueType
Pfam:P16-Arc 9 153 2.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149842
Predicted Effect probably benign
Transcript: ENSMUST00000153914
Predicted Effect unknown
Transcript: ENSMUST00000154210
AA Change: S72T
Predicted Effect probably damaging
Transcript: ENSMUST00000184996
AA Change: S749T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: S749T

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141467
Meta Mutation Damage Score 0.1229 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,465,053 (GRCm39) E30K unknown Het
Abi3bp A T 16: 56,491,670 (GRCm39) T1319S possibly damaging Het
Adam18 T C 8: 25,119,653 (GRCm39) probably null Het
Adgre1 G A 17: 57,713,839 (GRCm39) D175N possibly damaging Het
Adgrf1 T C 17: 43,614,679 (GRCm39) probably null Het
Ankhd1 A G 18: 36,777,652 (GRCm39) S1612G possibly damaging Het
Anks1 A G 17: 28,214,926 (GRCm39) R458G possibly damaging Het
Cacna1g C T 11: 94,350,523 (GRCm39) V441M probably damaging Het
Cadps2 A T 6: 23,321,781 (GRCm39) V1037E possibly damaging Het
Casz1 T C 4: 149,033,368 (GRCm39) V1380A possibly damaging Het
Cenpq T C 17: 41,244,085 (GRCm39) probably benign Het
Chrac1 T C 15: 72,965,376 (GRCm39) I93T possibly damaging Het
Cntnap2 T A 6: 45,986,571 (GRCm39) S359T probably benign Het
Col6a6 C A 9: 105,661,403 (GRCm39) M235I probably benign Het
Crat T C 2: 30,293,640 (GRCm39) probably benign Het
Cyp1a2 T C 9: 57,589,308 (GRCm39) N169D probably benign Het
Dennd1c T A 17: 57,374,649 (GRCm39) T499S probably benign Het
Dst A G 1: 34,333,631 (GRCm39) probably null Het
Dync2h1 G T 9: 7,167,244 (GRCm39) probably null Het
Eif3h C A 15: 51,662,660 (GRCm39) V129F probably damaging Het
Eno2 A G 6: 124,739,654 (GRCm39) F380L probably damaging Het
Ergic2 T A 6: 148,084,700 (GRCm39) I34F probably benign Het
Ergic3 G A 2: 155,858,707 (GRCm39) V278M probably benign Het
Fam185a C T 5: 21,664,283 (GRCm39) T339M probably damaging Het
Fam20b A T 1: 156,509,023 (GRCm39) D396E probably benign Het
Fasn G T 11: 120,707,008 (GRCm39) D881E probably damaging Het
Fat1 C A 8: 45,403,385 (GRCm39) H45Q probably benign Het
Fbxw16 A T 9: 109,261,550 (GRCm39) C439S probably benign Het
Garin1a T A 6: 29,281,391 (GRCm39) V43E possibly damaging Het
Gba2 A T 4: 43,570,832 (GRCm39) F280Y probably damaging Het
Gfm1 A G 3: 67,365,251 (GRCm39) I517V probably benign Het
Gng13 C T 17: 25,937,696 (GRCm39) Q8* probably null Het
Gphn A T 12: 78,637,433 (GRCm39) I381F probably damaging Het
Grm3 T C 5: 9,554,794 (GRCm39) N833D probably damaging Het
Gstt2 G T 10: 75,668,266 (GRCm39) T163K probably damaging Het
Gusb A T 5: 130,026,927 (GRCm39) V388E probably damaging Het
Hcrtr2 A T 9: 76,153,662 (GRCm39) Y243* probably null Het
Hspg2 A G 4: 137,242,734 (GRCm39) T650A possibly damaging Het
Ints2 C T 11: 86,139,677 (GRCm39) V306I probably damaging Het
Itga1 T A 13: 115,128,996 (GRCm39) D554V probably benign Het
Itgam C T 7: 127,680,806 (GRCm39) A245V probably damaging Het
Kcnk15 A G 2: 163,700,243 (GRCm39) T161A probably benign Het
Klhl18 A T 9: 110,257,749 (GRCm39) C564S probably benign Het
Krt40 T A 11: 99,432,540 (GRCm39) R159* probably null Het
L3mbtl4 G A 17: 68,762,775 (GRCm39) V103M probably damaging Het
Lnx2 C A 5: 146,955,850 (GRCm39) V649L possibly damaging Het
Lpp A T 16: 24,426,991 (GRCm39) Q39H probably damaging Het
Lrpprc A T 17: 85,060,540 (GRCm39) probably null Het
Map3k19 A T 1: 127,750,152 (GRCm39) N1066K probably benign Het
Mbtps2 G T X: 156,351,364 (GRCm39) T134K probably benign Het
Mfng C T 15: 78,648,637 (GRCm39) V147M possibly damaging Het
Mks1 T C 11: 87,748,754 (GRCm39) S273P probably benign Het
Myh2 T C 11: 67,071,647 (GRCm39) L488P probably damaging Het
Myo15a A G 11: 60,369,364 (GRCm39) N708S probably benign Het
Myo6 A T 9: 80,199,748 (GRCm39) N1019I probably damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Ncoa1 T G 12: 4,345,976 (GRCm39) N457T probably benign Het
Neb T C 2: 52,051,489 (GRCm39) probably null Het
Nlrp4e C A 7: 23,054,628 (GRCm39) N927K probably damaging Het
Npffr2 T C 5: 89,730,613 (GRCm39) M181T probably benign Het
Nxf7 A T X: 134,485,132 (GRCm39) C495S possibly damaging Het
Oas1g T C 5: 121,025,592 (GRCm39) T12A probably benign Het
Or11g2 T A 14: 50,856,036 (GRCm39) L119Q probably damaging Het
Or1e17 T A 11: 73,831,879 (GRCm39) V269E probably benign Het
Or2g7 C G 17: 38,378,562 (GRCm39) R167G possibly damaging Het
Or52s1b A T 7: 102,822,490 (GRCm39) V118E possibly damaging Het
Or5p60 A G 7: 107,724,023 (GRCm39) V149A probably benign Het
Papln C T 12: 83,830,153 (GRCm39) Q1008* probably null Het
Pcdhb10 A C 18: 37,545,485 (GRCm39) D187A probably damaging Het
Phf2 T A 13: 48,957,965 (GRCm39) E1016D unknown Het
Phf8 T A X: 150,335,618 (GRCm39) D197E probably benign Het
Pikfyve A G 1: 65,235,865 (GRCm39) H179R probably damaging Het
Prkcz T A 4: 155,353,597 (GRCm39) D250V probably damaging Het
Prpf4 A G 4: 62,340,842 (GRCm39) Y419C probably damaging Het
Prr15l C A 11: 96,825,440 (GRCm39) Y23* probably null Het
Prr5 T A 15: 84,587,152 (GRCm39) S301T probably benign Het
Psg16 T A 7: 16,829,088 (GRCm39) I224N probably benign Het
Radil A G 5: 142,529,226 (GRCm39) F186L probably damaging Het
Reg3g A T 6: 78,445,544 (GRCm39) M1K probably null Het
Rps6ka3 A G X: 158,100,963 (GRCm39) Y76C probably damaging Het
Rtl1 C T 12: 109,556,797 (GRCm39) V1681I possibly damaging Het
Sfmbt1 C T 14: 30,533,464 (GRCm39) R614C probably damaging Het
Slc12a4 A G 8: 106,678,599 (GRCm39) S244P probably benign Het
Sp140l2 T A 1: 85,247,773 (GRCm39) N5Y probably benign Het
Sptbn1 T C 11: 30,089,250 (GRCm39) T671A possibly damaging Het
Supt16 A T 14: 52,411,570 (GRCm39) N604K probably damaging Het
Synj2 G A 17: 6,080,058 (GRCm39) V1096I probably benign Het
Tas2r129 G T 6: 132,928,159 (GRCm39) C32F probably benign Het
Tbc1d25 T C X: 8,039,108 (GRCm39) Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 (GRCm39) D709G probably benign Het
Tfap2d C T 1: 19,174,591 (GRCm39) R15C possibly damaging Het
Tgfbi C A 13: 56,777,515 (GRCm39) T333N probably benign Het
Tnk1 T C 11: 69,746,508 (GRCm39) Y235C probably damaging Het
Ttc17 A G 2: 94,208,439 (GRCm39) F144S probably benign Het
Twnk G T 19: 44,996,578 (GRCm39) G337V possibly damaging Het
Unc13a A G 8: 72,110,676 (GRCm39) F464L probably benign Het
Usp17le C A 7: 104,417,667 (GRCm39) A492S probably damaging Het
Vmn1r213 A T 13: 23,195,932 (GRCm39) M172L probably benign Het
Vmn1r71 G A 7: 10,482,238 (GRCm39) T84I probably benign Het
Vmn2r109 C T 17: 20,761,336 (GRCm39) V674M probably damaging Het
Vmn2r19 A T 6: 123,312,945 (GRCm39) I672F possibly damaging Het
Vmn2r77 T C 7: 86,450,702 (GRCm39) V196A probably benign Het
Xdh T A 17: 74,205,357 (GRCm39) H1036L probably damaging Het
Zfp930 T A 8: 69,680,948 (GRCm39) Y214* probably null Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 38,942,985 (GRCm39) nonsense probably null
IGL00949:Golga1 APN 2 38,931,267 (GRCm39) missense probably damaging 0.98
IGL01133:Golga1 APN 2 38,913,484 (GRCm39) missense probably benign
IGL01592:Golga1 APN 2 38,953,294 (GRCm39) missense probably damaging 1.00
IGL01613:Golga1 APN 2 38,910,138 (GRCm39) missense probably benign 0.14
IGL01819:Golga1 APN 2 38,924,161 (GRCm39) missense probably benign 0.00
IGL01871:Golga1 APN 2 38,940,210 (GRCm39) splice site probably benign
IGL02744:Golga1 APN 2 38,908,486 (GRCm39) missense probably damaging 1.00
IGL02819:Golga1 APN 2 38,929,090 (GRCm39) missense probably null 0.97
IGL02874:Golga1 APN 2 38,929,104 (GRCm39) missense probably damaging 1.00
R0167:Golga1 UTSW 2 38,937,660 (GRCm39) missense probably benign 0.00
R0245:Golga1 UTSW 2 38,925,271 (GRCm39) missense probably benign 0.00
R0443:Golga1 UTSW 2 38,908,453 (GRCm39) missense probably damaging 1.00
R0906:Golga1 UTSW 2 38,937,655 (GRCm39) missense probably damaging 0.99
R1508:Golga1 UTSW 2 38,913,261 (GRCm39) missense probably benign
R1901:Golga1 UTSW 2 38,937,792 (GRCm39) splice site probably null
R1964:Golga1 UTSW 2 38,937,099 (GRCm39) missense probably benign 0.00
R2228:Golga1 UTSW 2 38,913,183 (GRCm39) missense probably benign 0.02
R3734:Golga1 UTSW 2 38,940,182 (GRCm39) missense possibly damaging 0.88
R4407:Golga1 UTSW 2 38,909,653 (GRCm39) splice site probably null
R4504:Golga1 UTSW 2 38,913,466 (GRCm39) missense probably benign 0.00
R4973:Golga1 UTSW 2 38,929,118 (GRCm39) missense probably damaging 0.99
R5049:Golga1 UTSW 2 38,937,747 (GRCm39) missense probably damaging 1.00
R5600:Golga1 UTSW 2 38,910,111 (GRCm39) missense probably damaging 1.00
R6008:Golga1 UTSW 2 38,937,099 (GRCm39) missense probably benign 0.00
R6374:Golga1 UTSW 2 38,924,080 (GRCm39) missense probably benign
R6388:Golga1 UTSW 2 38,913,183 (GRCm39) missense probably benign 0.02
R6601:Golga1 UTSW 2 38,910,118 (GRCm39) missense probably damaging 1.00
R7067:Golga1 UTSW 2 38,937,731 (GRCm39) missense probably benign 0.00
R7816:Golga1 UTSW 2 38,942,110 (GRCm39) missense probably damaging 1.00
R9277:Golga1 UTSW 2 38,914,255 (GRCm39) missense probably benign 0.19
R9581:Golga1 UTSW 2 38,909,573 (GRCm39) missense probably damaging 1.00
X0025:Golga1 UTSW 2 38,942,074 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGCACTGTGGAAATCTGGGC -3'
(R):5'- CCCCATGAAATTGCTAAGGCACCTG -3'

Sequencing Primer
(F):5'- AGTTCATTATCAGTCTACAGGGAGG -3'
(R):5'- GGGAGGAACCTCTTACAGTTCAC -3'
Posted On 2013-04-24