Incidental Mutation 'R4112:Bace2'
ID 314486
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 040989-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R4112 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97237856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 436 (T436A)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047275
AA Change: T436A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: T436A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000231892
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Aamp A G 1: 74,320,386 (GRCm39) probably benign Het
Abcb4 A G 5: 8,986,783 (GRCm39) probably null Het
Adam6b T A 12: 113,453,256 (GRCm39) F24L possibly damaging Het
Alms1 G A 6: 85,597,870 (GRCm39) V1368I probably benign Het
Angpt2 T A 8: 18,749,139 (GRCm39) Q326L probably damaging Het
Armc9 T A 1: 86,116,661 (GRCm39) I327N possibly damaging Het
Ccdc162 T A 10: 41,532,324 (GRCm39) E450V possibly damaging Het
Ccdc7b G T 8: 129,811,708 (GRCm39) probably benign Het
Cdh17 T C 4: 11,814,628 (GRCm39) S728P probably damaging Het
Chia1 T C 3: 106,035,844 (GRCm39) L168P probably damaging Het
Cnot1 A C 8: 96,500,246 (GRCm39) L111V probably damaging Het
Col14a1 A T 15: 55,226,955 (GRCm39) N235I unknown Het
Col2a1 A C 15: 97,881,582 (GRCm39) L787R probably benign Het
Cyp3a25 A T 5: 145,939,841 (GRCm39) D55E probably benign Het
Dennd6a A T 14: 26,349,673 (GRCm39) probably benign Het
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Etfbkmt T C 6: 149,046,089 (GRCm39) probably benign Het
Etfrf1 T C 6: 145,161,098 (GRCm39) Y23H probably damaging Het
Gemin4 T A 11: 76,103,645 (GRCm39) E372V probably damaging Het
Glyr1 T C 16: 4,836,350 (GRCm39) K500E possibly damaging Het
Gm10271 A T 10: 116,803,943 (GRCm39) probably benign Het
Gm20775 A T Y: 10,641,878 (GRCm39) noncoding transcript Het
Gm5578 A G 6: 112,583,466 (GRCm39) noncoding transcript Het
Gxylt2 A G 6: 100,760,167 (GRCm39) N234S probably damaging Het
Kcna6 G C 6: 126,716,737 (GRCm39) R51G probably damaging Het
Klf17 A G 4: 117,617,898 (GRCm39) V153A possibly damaging Het
L3mbtl2 T C 15: 81,566,170 (GRCm39) V331A possibly damaging Het
Med1 A T 11: 98,070,913 (GRCm39) V110E probably damaging Het
Nsmaf A C 4: 6,417,188 (GRCm39) Y535* probably null Het
Pcdh10 G A 3: 45,336,055 (GRCm39) V790M probably damaging Het
Phlpp1 A G 1: 106,292,068 (GRCm39) T976A probably damaging Het
Prelid3a T C 18: 67,605,967 (GRCm39) Y25H probably damaging Het
Ptprk T A 10: 28,351,284 (GRCm39) probably null Het
Rbm5 A T 9: 107,642,796 (GRCm39) D79E probably damaging Het
Rhox3f G T X: 36,763,672 (GRCm39) E140* probably null Het
Rnd3 T A 2: 51,038,242 (GRCm39) T78S possibly damaging Het
Scart2 G T 7: 139,878,281 (GRCm39) G1003* probably null Het
Sgca T C 11: 94,863,396 (GRCm39) T27A possibly damaging Het
Slc10a2 C T 8: 5,155,135 (GRCm39) D17N probably benign Het
Snap23 C T 2: 120,414,856 (GRCm39) probably benign Het
Sptb T A 12: 76,644,553 (GRCm39) T2098S probably damaging Het
Src T A 2: 157,304,946 (GRCm39) L165H probably damaging Het
Srr G T 11: 74,803,898 (GRCm39) Q20K probably benign Het
Stt3b A T 9: 115,095,206 (GRCm39) F275Y probably damaging Het
Sucnr1 C G 3: 59,994,215 (GRCm39) R248G probably damaging Het
Thsd7b A T 1: 130,044,356 (GRCm39) D1112V probably benign Het
Tmem80 A G 7: 140,913,692 (GRCm39) probably benign Het
Top2a C A 11: 98,913,786 (GRCm39) K18N probably damaging Het
Ttc24 T A 3: 87,981,946 (GRCm39) D40V probably damaging Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Zfp3 T A 11: 70,662,333 (GRCm39) S97R probably benign Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTTCACTCCTGAGGGC -3'
(R):5'- TCTGACTAGTGAGGACTCATCG -3'

Sequencing Primer
(F):5'- TTCACTCCTGAGGGCATGCTG -3'
(R):5'- GGACTCATCGTTAACTACCTCAGGG -3'
Posted On 2015-05-14