Incidental Mutation 'R4112:Bace2'
ID314486
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Namebeta-site APP-cleaving enzyme 2
Synonyms1110059C24Rik, ARP1, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 040989-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4112 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97356742-97442936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97436656 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 436 (T436A)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
Predicted Effect probably benign
Transcript: ENSMUST00000047275
AA Change: T436A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: T436A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000231892
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
5830411N06Rik G T 7: 140,298,368 G1003* probably null Het
Aamp A G 1: 74,281,227 probably benign Het
Abcb4 A G 5: 8,936,783 probably null Het
Adam6b T A 12: 113,489,636 F24L possibly damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Angpt2 T A 8: 18,699,123 Q326L probably damaging Het
Armc9 T A 1: 86,188,939 I327N possibly damaging Het
Ccdc162 T A 10: 41,656,328 E450V possibly damaging Het
Ccdc7b G T 8: 129,085,227 probably benign Het
Cdh17 T C 4: 11,814,628 S728P probably damaging Het
Chia1 T C 3: 106,128,528 L168P probably damaging Het
Cnot1 A C 8: 95,773,618 L111V probably damaging Het
Col14a1 A T 15: 55,363,559 N235I unknown Het
Col2a1 A C 15: 97,983,701 L787R probably benign Het
Cyp3a25 A T 5: 146,003,031 D55E probably benign Het
Dennd6a A T 14: 26,628,518 probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Etfbkmt T C 6: 149,144,591 probably benign Het
Etfrf1 T C 6: 145,215,372 Y23H probably damaging Het
Gemin4 T A 11: 76,212,819 E372V probably damaging Het
Glyr1 T C 16: 5,018,486 K500E possibly damaging Het
Gm10271 A T 10: 116,968,038 probably benign Het
Gm20775 A T Y: 10,641,878 noncoding transcript Het
Gm5578 A G 6: 112,606,505 noncoding transcript Het
Gxylt2 A G 6: 100,783,206 N234S probably damaging Het
Kcna6 G C 6: 126,739,774 R51G probably damaging Het
Klf17 A G 4: 117,760,701 V153A possibly damaging Het
L3mbtl2 T C 15: 81,681,969 V331A possibly damaging Het
Med1 A T 11: 98,180,087 V110E probably damaging Het
Nsmaf A C 4: 6,417,188 Y535* probably null Het
Pcdh10 G A 3: 45,381,620 V790M probably damaging Het
Phlpp1 A G 1: 106,364,338 T976A probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprk T A 10: 28,475,288 probably null Het
Rbm5 A T 9: 107,765,597 D79E probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Rnd3 T A 2: 51,148,230 T78S possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc10a2 C T 8: 5,105,135 D17N probably benign Het
Snap23 C T 2: 120,584,375 probably benign Het
Sptb T A 12: 76,597,779 T2098S probably damaging Het
Src T A 2: 157,463,026 L165H probably damaging Het
Srr G T 11: 74,913,072 Q20K probably benign Het
Stt3b A T 9: 115,266,138 F275Y probably damaging Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tmem80 A G 7: 141,333,779 probably benign Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Ttc24 T A 3: 88,074,639 D40V probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp3 T A 11: 70,771,507 S97R probably benign Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97408430 missense probably damaging 0.97
IGL02660:Bace2 APN 16 97415140 missense probably damaging 1.00
IGL02669:Bace2 APN 16 97436893 makesense probably null
R0244:Bace2 UTSW 16 97436773 splice site probably null
R0674:Bace2 UTSW 16 97436749 missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97356941 missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97356860 missense unknown
R1670:Bace2 UTSW 16 97412135 missense probably damaging 0.96
R1997:Bace2 UTSW 16 97415089 missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97412136 missense probably damaging 1.00
R2937:Bace2 UTSW 16 97412188 critical splice donor site probably null
R2938:Bace2 UTSW 16 97412188 critical splice donor site probably null
R3103:Bace2 UTSW 16 97422001 critical splice donor site probably null
R3755:Bace2 UTSW 16 97436657 missense probably benign 0.34
R4110:Bace2 UTSW 16 97436656 missense probably benign
R4113:Bace2 UTSW 16 97436656 missense probably benign
R4560:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4562:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4563:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4717:Bace2 UTSW 16 97436873 missense probably damaging 1.00
R5535:Bace2 UTSW 16 97413425 missense probably damaging 1.00
R6282:Bace2 UTSW 16 97415097 missense probably damaging 1.00
R6364:Bace2 UTSW 16 97413433 missense probably benign 0.05
R7045:Bace2 UTSW 16 97399665 missense probably damaging 1.00
R7241:Bace2 UTSW 16 97436798 missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97399682 missense probably benign 0.01
R7653:Bace2 UTSW 16 97436652 missense
R8026:Bace2 UTSW 16 97436852 missense probably benign 0.26
R8171:Bace2 UTSW 16 97424586 missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97413470 missense probably damaging 1.00
X0024:Bace2 UTSW 16 97413398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTTCACTCCTGAGGGC -3'
(R):5'- TCTGACTAGTGAGGACTCATCG -3'

Sequencing Primer
(F):5'- TTCACTCCTGAGGGCATGCTG -3'
(R):5'- GGACTCATCGTTAACTACCTCAGGG -3'
Posted On2015-05-14