Incidental Mutation 'R4113:Hrh3'
ID 314495
Institutional Source Beutler Lab
Gene Symbol Hrh3
Ensembl Gene ENSMUSG00000039059
Gene Name histamine receptor H3
Synonyms Eae8
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R4113 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 179741258-179746264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 179744643 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 99 (R99L)
Ref Sequence ENSEMBL: ENSMUSP00000127053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056480] [ENSMUST00000163215] [ENSMUST00000164442] [ENSMUST00000165248] [ENSMUST00000165762] [ENSMUST00000171736] [ENSMUST00000166724]
AlphaFold P58406
Predicted Effect probably benign
Transcript: ENSMUST00000056480
AA Change: R99L

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049963
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 7.2e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163215
AA Change: R99L

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127053
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 376 2e-55 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164442
AA Change: R99L

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130553
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 380 4.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165248
AA Change: R99L

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130181
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 364 6.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165762
AA Change: R99L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132203
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 1.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166392
Predicted Effect possibly damaging
Transcript: ENSMUST00000171736
AA Change: R99L

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127085
Gene: ENSMUSG00000039059
AA Change: R99L

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 239 5.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172211
Predicted Effect probably benign
Transcript: ENSMUST00000166724
SMART Domains Protein: ENSMUSP00000126336
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 93 1.8e-8 PFAM
Meta Mutation Damage Score 0.1222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced locomotor activity and body temperature, and attenuated behavioral responses to the drugs thioperamide, methamphetamine, and scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,237,856 (GRCm39) T436A probably benign Het
BC024139 A G 15: 76,005,827 (GRCm39) M458T probably benign Het
Casp2 G A 6: 42,244,828 (GRCm39) A76T probably damaging Het
Catsper3 A G 13: 55,934,183 (GRCm39) K35E probably damaging Het
Ccdc88c A G 12: 100,911,332 (GRCm39) L34P probably damaging Het
Dcaf13 T A 15: 38,993,615 (GRCm39) I236N probably damaging Het
Dip2c G T 13: 9,687,137 (GRCm39) G1254C probably damaging Het
Dnah12 T C 14: 26,414,722 (GRCm39) L41P probably damaging Het
Dnah17 T C 11: 118,003,420 (GRCm39) K514R possibly damaging Het
Dnajb12 T A 10: 59,730,136 (GRCm39) S270R possibly damaging Het
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Eya4 G T 10: 23,031,849 (GRCm39) S235Y probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Gdf3 A G 6: 122,584,016 (GRCm39) I117T probably damaging Het
Gm5611 T A 9: 16,941,989 (GRCm39) noncoding transcript Het
Gtf3c4 G A 2: 28,717,567 (GRCm39) T771I probably damaging Het
Hyls1 T A 9: 35,472,714 (GRCm39) Y234F probably damaging Het
Irak1bp1 T C 9: 82,728,728 (GRCm39) S220P probably benign Het
Lama1 G A 17: 68,071,698 (GRCm39) V862I probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Or14a258 G A 7: 86,035,733 (GRCm39) T45M possibly damaging Het
Or4b12 A T 2: 90,096,684 (GRCm39) L30H probably damaging Het
Pcdh8 T C 14: 80,004,953 (GRCm39) D927G probably damaging Het
Prelid3a T C 18: 67,605,967 (GRCm39) Y25H probably damaging Het
Ptprm T C 17: 67,032,808 (GRCm39) D1015G probably damaging Het
Rhox3f G T X: 36,763,672 (GRCm39) E140* probably null Het
Riox2 C T 16: 59,312,257 (GRCm39) L465F probably benign Het
Sec31b G T 19: 44,512,968 (GRCm39) T507N possibly damaging Het
Stab1 C T 14: 30,890,436 (GRCm39) R5Q probably damaging Het
Stmn3 T C 2: 180,949,089 (GRCm39) K135E possibly damaging Het
Synj2 G A 17: 6,058,240 (GRCm39) G243S probably benign Het
Tasor C T 14: 27,181,918 (GRCm39) R483* probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tshz2 C A 2: 169,727,450 (GRCm39) P213Q probably benign Het
Tssk4 A G 14: 55,887,830 (GRCm39) T9A probably benign Het
Ube4a T A 9: 44,860,247 (GRCm39) I272F probably damaging Het
Unc79 T C 12: 103,025,629 (GRCm39) C339R probably damaging Het
Vmn2r87 T C 10: 130,315,691 (GRCm39) D125G probably benign Het
Yap1 A T 9: 7,938,432 (GRCm39) *358K probably null Het
Zfp992 C T 4: 146,551,976 (GRCm39) H566Y probably damaging Het
Other mutations in Hrh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Hrh3 APN 2 179,742,896 (GRCm39) missense possibly damaging 0.69
IGL01827:Hrh3 APN 2 179,745,739 (GRCm39) missense possibly damaging 0.95
IGL01912:Hrh3 APN 2 179,743,169 (GRCm39) missense probably damaging 1.00
IGL02992:Hrh3 APN 2 179,742,608 (GRCm39) missense probably benign 0.11
IGL03273:Hrh3 APN 2 179,742,441 (GRCm39) missense possibly damaging 0.85
R1403:Hrh3 UTSW 2 179,744,547 (GRCm39) missense probably damaging 1.00
R1403:Hrh3 UTSW 2 179,744,547 (GRCm39) missense probably damaging 1.00
R1808:Hrh3 UTSW 2 179,741,577 (GRCm39) unclassified probably benign
R2060:Hrh3 UTSW 2 179,743,043 (GRCm39) missense possibly damaging 0.95
R4110:Hrh3 UTSW 2 179,744,643 (GRCm39) missense possibly damaging 0.84
R4111:Hrh3 UTSW 2 179,744,643 (GRCm39) missense possibly damaging 0.84
R4330:Hrh3 UTSW 2 179,741,665 (GRCm39) unclassified probably benign
R4935:Hrh3 UTSW 2 179,743,061 (GRCm39) missense probably damaging 1.00
R5050:Hrh3 UTSW 2 179,742,350 (GRCm39) missense probably damaging 1.00
R5543:Hrh3 UTSW 2 179,745,763 (GRCm39) missense probably damaging 0.99
R5780:Hrh3 UTSW 2 179,742,608 (GRCm39) missense probably damaging 0.96
R7571:Hrh3 UTSW 2 179,743,079 (GRCm39) missense probably damaging 0.98
R8699:Hrh3 UTSW 2 179,743,149 (GRCm39) missense probably damaging 0.99
R9603:Hrh3 UTSW 2 179,742,444 (GRCm39) nonsense probably null
R9698:Hrh3 UTSW 2 179,743,206 (GRCm39) missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CCTATAACTCAGGAGCAGCC -3'
(R):5'- ATGGCAGCTGCTCAGTTGTAG -3'

Sequencing Primer
(F):5'- AGCCATACCCTGTCCAGTG -3'
(R):5'- CTGCTCAGTTGTAGGGGGACAG -3'
Posted On 2015-05-14