Incidental Mutation 'R4113:Zfp992'
ID314498
Institutional Source Beutler Lab
Gene Symbol Zfp992
Ensembl Gene ENSMUSG00000070605
Gene Namezinc finger protein 992
SynonymsGm13251
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4113 (G1)
Quality Score89
Status Not validated
Chromosome4
Chromosomal Location146449023-146470292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 146467519 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 566 (H566Y)
Ref Sequence ENSEMBL: ENSMUSP00000101359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105733]
Predicted Effect probably damaging
Transcript: ENSMUST00000105733
AA Change: H566Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101359
Gene: ENSMUSG00000070605
AA Change: H566Y

DomainStartEndE-ValueType
KRAB 13 74 5.08e-16 SMART
ZnF_C2H2 240 262 4.47e-3 SMART
ZnF_C2H2 268 290 5.21e-4 SMART
ZnF_C2H2 296 318 9.08e-4 SMART
ZnF_C2H2 324 346 5.21e-4 SMART
ZnF_C2H2 352 374 7.37e-4 SMART
ZnF_C2H2 380 402 2.43e-4 SMART
ZnF_C2H2 408 430 7.37e-4 SMART
ZnF_C2H2 436 458 9.08e-4 SMART
ZnF_C2H2 464 486 7.37e-4 SMART
ZnF_C2H2 492 514 1.04e-3 SMART
ZnF_C2H2 520 542 7.49e-5 SMART
ZnF_C2H2 548 566 6.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181199
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Other mutations in Zfp992
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Zfp992 UTSW 4 146466007 nonsense probably null
PIT4131001:Zfp992 UTSW 4 146466112 missense probably benign 0.00
PIT4142001:Zfp992 UTSW 4 146466112 missense probably benign 0.00
R1709:Zfp992 UTSW 4 146466492 missense probably benign 0.00
R3711:Zfp992 UTSW 4 146467519 missense probably damaging 1.00
R4081:Zfp992 UTSW 4 146467519 missense probably damaging 1.00
R4821:Zfp992 UTSW 4 146467519 missense probably damaging 1.00
R7709:Zfp992 UTSW 4 146467165 nonsense probably null
R7839:Zfp992 UTSW 4 146466418 missense probably benign 0.24
R8383:Zfp992 UTSW 4 146466676 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGTCTGAGGATTCATCAGAG -3'
(R):5'- GGCCAAGAGTAAAGGATTCATACC -3'

Sequencing Primer
(F):5'- CAGTCTGAGGATTCATCAGAGAATTC -3'
(R):5'- CTTGGTAAAGGATTGTCTCG -3'
Posted On2015-05-14