Incidental Mutation 'R4113:Casp2'
ID314499
Institutional Source Beutler Lab
Gene Symbol Casp2
Ensembl Gene ENSMUSG00000029863
Gene Namecaspase 2
SynonymsNedd2, Caspase-2, Ich-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42264985-42282508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42267894 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 76 (A76T)
Ref Sequence ENSEMBL: ENSMUSP00000121184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031895] [ENSMUST00000095987] [ENSMUST00000156829]
Predicted Effect probably damaging
Transcript: ENSMUST00000031895
AA Change: A76T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031895
Gene: ENSMUSG00000029863
AA Change: A76T

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 447 3.27e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095987
SMART Domains Protein: ENSMUSP00000100590
Gene: ENSMUSG00000071506

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:TMEM51 58 194 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144821
Predicted Effect probably damaging
Transcript: ENSMUST00000156829
AA Change: A76T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121184
Gene: ENSMUSG00000029863
AA Change: A76T

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 341 8.07e-38 SMART
Meta Mutation Damage Score 0.3167 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the evolutionarily ancient and most conserved member of the cysteine proteases that plays important role in stress-induced apoptosis, DNA repair and tumor suppression. Mice lacking the encoded protein develop normally but display cell type-specific apoptotic defects. Germ cells and oocytes from such mice were found to be resistant to cell death after treatment with chemotherapeutic drugs. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal apoptosis. Apoptosis is reduced in the female germline, but is increased in sympathetic neurons during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Casp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Casp2 APN 6 42269285 nonsense probably null
IGL02094:Casp2 APN 6 42280359 missense probably damaging 1.00
IGL02371:Casp2 APN 6 42267968 missense probably benign 0.00
IGL02414:Casp2 APN 6 42280446 missense probably damaging 1.00
IGL03298:Casp2 APN 6 42268990 splice site probably benign
R1240:Casp2 UTSW 6 42268945 missense probably damaging 1.00
R1424:Casp2 UTSW 6 42276791 splice site probably benign
R1672:Casp2 UTSW 6 42268908 missense probably damaging 1.00
R4110:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R5062:Casp2 UTSW 6 42269272 splice site probably benign
R5469:Casp2 UTSW 6 42269334 missense probably benign 0.00
R5835:Casp2 UTSW 6 42267586 missense possibly damaging 0.84
R5877:Casp2 UTSW 6 42276637 intron probably benign
R6103:Casp2 UTSW 6 42279880 missense probably damaging 0.99
R6667:Casp2 UTSW 6 42279836 missense probably damaging 1.00
R6702:Casp2 UTSW 6 42268051 missense probably benign
R6754:Casp2 UTSW 6 42269330 missense probably damaging 1.00
R7141:Casp2 UTSW 6 42280395 missense possibly damaging 0.68
R7255:Casp2 UTSW 6 42268907 missense probably damaging 1.00
R7611:Casp2 UTSW 6 42274038 missense possibly damaging 0.95
X0065:Casp2 UTSW 6 42280143 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAAACTGGTCTGAGGCAGGC -3'
(R):5'- ACAGTCCTAGGGCTTCATACC -3'

Sequencing Primer
(F):5'- TCTGAGGCAGGCTTGGAGAAG -3'
(R):5'- CTTCATACCGGTGGGAGTAC -3'
Posted On2015-05-14