Incidental Mutation 'R4113:Gdf3'
ID314500
Institutional Source Beutler Lab
Gene Symbol Gdf3
Ensembl Gene ENSMUSG00000030117
Gene Namegrowth differentiation factor 3
SynonymsGdf-3, Vgr-2, ecat9, Vgr2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122605403-122610087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122607057 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 117 (I117T)
Ref Sequence ENSEMBL: ENSMUSP00000032211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032211] [ENSMUST00000112585] [ENSMUST00000112586] [ENSMUST00000147760] [ENSMUST00000203197] [ENSMUST00000203309]
Predicted Effect probably damaging
Transcript: ENSMUST00000032211
AA Change: I117T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032211
Gene: ENSMUSG00000030117
AA Change: I117T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 57 68 N/A INTRINSIC
Pfam:TGFb_propeptide 91 222 3.1e-7 PFAM
TGFB 266 366 6.86e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112585
SMART Domains Protein: ENSMUSP00000108204
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 15 181 3.6e-38 PFAM
Pfam:APOBEC_C 124 178 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112586
SMART Domains Protein: ENSMUSP00000108205
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 15 181 3.6e-38 PFAM
Pfam:APOBEC_C 124 178 9.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143356
Predicted Effect probably benign
Transcript: ENSMUST00000147760
Predicted Effect probably benign
Transcript: ENSMUST00000203197
Predicted Effect probably benign
Transcript: ENSMUST00000203309
SMART Domains Protein: ENSMUSP00000145417
Gene: ENSMUSG00000040613

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 121 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204882
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein is important in embryogenesis and likely plays a role ocular and skeletal development. Mice lacking a functional copy of this gene exhibit defects in early embryonic development resulting in embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit prenatal lethality and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Gdf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Gdf3 APN 6 122607126 missense probably damaging 1.00
R0396:Gdf3 UTSW 6 122607135 missense probably damaging 1.00
R1503:Gdf3 UTSW 6 122606337 missense probably damaging 1.00
R1553:Gdf3 UTSW 6 122609765 missense probably benign 0.02
R1762:Gdf3 UTSW 6 122606407 missense possibly damaging 0.71
R1824:Gdf3 UTSW 6 122609962 missense probably benign 0.33
R2696:Gdf3 UTSW 6 122606900 missense probably benign
R3963:Gdf3 UTSW 6 122606758 missense probably benign 0.00
R5090:Gdf3 UTSW 6 122609754 missense probably benign 0.12
R5257:Gdf3 UTSW 6 122606386 missense probably damaging 1.00
R7132:Gdf3 UTSW 6 122606324 missense probably damaging 1.00
R7615:Gdf3 UTSW 6 122606916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATCCTTAAGCGCACCCTG -3'
(R):5'- CCAGAAGGGAGTGTTTGACTG -3'

Sequencing Primer
(F):5'- TGAACTGGAGCTGACCTTGAG -3'
(R):5'- AAGGGAGTGTTTGACTGGAGCTC -3'
Posted On2015-05-14