Incidental Mutation 'R4113:Hyls1'
ID314505
Institutional Source Beutler Lab
Gene Symbol Hyls1
Ensembl Gene ENSMUSG00000050555
Gene NameHYLS1, centriolar and ciliogenesis associated
Synonyms3010015K02Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35560820-35570398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35561418 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 234 (Y234F)
Ref Sequence ENSEMBL: ENSMUSP00000110762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034612] [ENSMUST00000034615] [ENSMUST00000115110] [ENSMUST00000121246]
Predicted Effect probably benign
Transcript: ENSMUST00000034612
SMART Domains Protein: ENSMUSP00000034612
Gene: ENSMUSG00000032101

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 101 111 N/A INTRINSIC
DEXDc 117 316 1.26e-41 SMART
HELICc 353 440 6.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034615
SMART Domains Protein: ENSMUSP00000034615
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 6.8e-12 PFAM
Pfam:PseudoU_synth_1 213 331 4.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115110
AA Change: Y234F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110762
Gene: ENSMUSG00000050555
AA Change: Y234F

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
Pfam:HYLS1_C 211 299 6.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121246
SMART Domains Protein: ENSMUSP00000113382
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 3e-12 PFAM
Pfam:PseudoU_synth_1 213 316 1.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135768
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized to the cytoplasm. Mutations in this gene are associated with hydrolethalus syndrome. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Hyls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Hyls1 APN 9 35561924 nonsense probably null
IGL00964:Hyls1 APN 9 35562112 intron probably benign
IGL01936:Hyls1 APN 9 35562067 missense probably benign
IGL02979:Hyls1 APN 9 35561674 missense probably benign 0.00
R0519:Hyls1 UTSW 9 35561203 missense probably damaging 1.00
R0894:Hyls1 UTSW 9 35561232 missense probably damaging 1.00
R2302:Hyls1 UTSW 9 35564069 missense possibly damaging 0.55
R3909:Hyls1 UTSW 9 35561409 missense probably damaging 1.00
R4111:Hyls1 UTSW 9 35561418 missense probably damaging 1.00
R5725:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5727:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5833:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5834:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5835:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6030:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6030:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6031:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6031:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6037:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6037:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6269:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6270:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6271:Hyls1 UTSW 9 35561184 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCAAGGTCACAACGCAC -3'
(R):5'- GAATCCCCAGTTGTCACTTCAC -3'

Sequencing Primer
(F):5'- GGTCACAACGCACACCCC -3'
(R):5'- CCATGTGAATACCAAGGAATTTCAC -3'
Posted On2015-05-14