Mutagenetix > Incidental Mutation

Incidental Mutation 'R4113:Hyls1'

314505

Institutional Source

Beutler Lab

Gene Symbol

Hyls1

Ensembl Gene

ENSMUSG00000050555

Gene Name

HYLS1, centriolar and ciliogenesis associated

Synonyms

3010015K02Rik

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R4113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35560820-35570398 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 35561418 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 234 (Y234F)

Ref Sequence

ENSEMBL: ENSMUSP00000110762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034612] [ENSMUST00000034615] [ENSMUST00000115110] [ENSMUST00000121246]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034612

SMART Domains

Protein: ENSMUSP00000034612
Gene: ENSMUSG00000032101

Domain	Start	End	E-Value	Type
low complexity region	50	61	N/A	INTRINSIC
low complexity region	101	111	N/A	INTRINSIC
DEXDc	117	316	1.26e-41	SMART
HELICc	353	440	6.18e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000034615

SMART Domains

Protein: ENSMUSP00000034615
Gene: ENSMUSG00000032103

Domain	Start	End	E-Value	Type
coiled coil region	1	46	N/A	INTRINSIC
Pfam:PseudoU_synth_1	68	190	6.8e-12	PFAM
Pfam:PseudoU_synth_1	213	331	4.8e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115110
AA Change: Y234F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110762
Gene: ENSMUSG00000050555
AA Change: Y234F

Domain	Start	End	E-Value	Type
low complexity region	87	100	N/A	INTRINSIC
Pfam:HYLS1_C	211	299	6.4e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121246

SMART Domains

Protein: ENSMUSP00000113382
Gene: ENSMUSG00000032103

Domain	Start	End	E-Value	Type
coiled coil region	1	46	N/A	INTRINSIC
Pfam:PseudoU_synth_1	68	190	3e-12	PFAM
Pfam:PseudoU_synth_1	213	316	1.5e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135768

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized to the cytoplasm. Mutations in this gene are associated with hydrolethalus syndrome. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bace2	A	G	16: 97,436,656	T436A	probably benign	Het
BC024139	A	G	15: 76,121,627	M458T	probably benign	Het
Casp2	G	A	6: 42,267,894	A76T	probably damaging	Het
Catsper3	A	G	13: 55,786,370	K35E	probably damaging	Het
Ccdc88c	A	G	12: 100,945,073	L34P	probably damaging	Het
Dcaf13	T	A	15: 39,130,220	I236N	probably damaging	Het
Dip2c	G	T	13: 9,637,101	G1254C	probably damaging	Het
Dnah12	T	C	14: 26,693,567	L41P	probably damaging	Het
Dnah17	T	C	11: 118,112,594	K514R	possibly damaging	Het
Dnajb12	T	A	10: 59,894,314	S270R	possibly damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Eya4	G	T	10: 23,155,951	S235Y	probably damaging	Het
Fam208a	C	T	14: 27,459,961	R483*	probably null	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gdf3	A	G	6: 122,607,057	I117T	probably damaging	Het
Gm5611	T	A	9: 17,030,693		noncoding transcript	Het
Gtf3c4	G	A	2: 28,827,555	T771I	probably damaging	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Irak1bp1	T	C	9: 82,846,675	S220P	probably benign	Het
Lama1	G	A	17: 67,764,703	V862I	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Olfr1271	A	T	2: 90,266,340	L30H	probably damaging	Het
Olfr304	G	A	7: 86,386,525	T45M	possibly damaging	Het
Pcdh8	T	C	14: 79,767,513	D927G	probably damaging	Het
Prelid3a	T	C	18: 67,472,897	Y25H	probably damaging	Het
Ptprm	T	C	17: 66,725,813	D1015G	probably damaging	Het
Rhox3f	G	T	X: 37,582,019	E140*	probably null	Het
Riox2	C	T	16: 59,491,894	L465F	probably benign	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Stab1	C	T	14: 31,168,479	R5Q	probably damaging	Het
Stmn3	T	C	2: 181,307,296	K135E	possibly damaging	Het
Synj2	G	A	17: 6,007,965	G243S	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tshz2	C	A	2: 169,885,530	P213Q	probably benign	Het
Tssk4	A	G	14: 55,650,373	T9A	probably benign	Het
Ube4a	T	A	9: 44,948,949	I272F	probably damaging	Het
Unc79	T	C	12: 103,059,370	C339R	probably damaging	Het
Vmn2r87	T	C	10: 130,479,822	D125G	probably benign	Het
Yap1	A	T	9: 7,938,431	*358K	probably null	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Hyls1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00533:Hyls1	APN	9	35561924	nonsense	probably null
IGL00964:Hyls1	APN	9	35562112	intron	probably benign
IGL01936:Hyls1	APN	9	35562067	missense	probably benign
IGL02979:Hyls1	APN	9	35561674	missense	probably benign	0.00
R0519:Hyls1	UTSW	9	35561203	missense	probably damaging	1.00
R0894:Hyls1	UTSW	9	35561232	missense	probably damaging	1.00
R2302:Hyls1	UTSW	9	35564069	missense	possibly damaging	0.55
R3909:Hyls1	UTSW	9	35561409	missense	probably damaging	1.00
R4111:Hyls1	UTSW	9	35561418	missense	probably damaging	1.00
R5725:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R5727:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R5833:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R5834:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R5835:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6030:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6030:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6031:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6031:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6037:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6037:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6269:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6270:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R6271:Hyls1	UTSW	9	35561184	missense	probably benign	0.01
R8685:Hyls1	UTSW	9	35561428	missense	probably damaging	1.00
R9532:Hyls1	UTSW	9	35562102	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTGCAAGGTCACAACGCAC -3'
(R):5'- GAATCCCCAGTTGTCACTTCAC -3'

Sequencing Primer
(F):5'- GGTCACAACGCACACCCC -3'
(R):5'- CCATGTGAATACCAAGGAATTTCAC -3'

Posted On

2015-05-14