Incidental Mutation 'R4113:Ube4a'
ID314506
Institutional Source Beutler Lab
Gene Symbol Ube4a
Ensembl Gene ENSMUSG00000059890
Gene Nameubiquitination factor E4A
Synonyms9930123J21Rik, UFD2b, 4732444G18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44923127-44965600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44948949 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 272 (I272F)
Ref Sequence ENSEMBL: ENSMUSP00000149791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000125642] [ENSMUST00000138559] [ENSMUST00000145657] [ENSMUST00000154287] [ENSMUST00000213193] [ENSMUST00000213666] [ENSMUST00000213890] [ENSMUST00000214761]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117506
AA Change: I253F

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890
AA Change: I253F

DomainStartEndE-ValueType
low complexity region 288 299 N/A INTRINSIC
Pfam:Ufd2P_core 330 766 2.6e-101 PFAM
Pfam:Ufd2P_core 762 935 7.4e-61 PFAM
Ubox 953 1016 1.9e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117549
AA Change: I272F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890
AA Change: I272F

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 991 3.4e-155 PFAM
Ubox 1010 1073 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125642
Predicted Effect probably damaging
Transcript: ENSMUST00000138559
AA Change: I272F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000145657
Predicted Effect probably benign
Transcript: ENSMUST00000154287
AA Change: I272F

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890
AA Change: I272F

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 547 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213193
Predicted Effect probably benign
Transcript: ENSMUST00000213666
Predicted Effect probably benign
Transcript: ENSMUST00000213890
Predicted Effect probably benign
Transcript: ENSMUST00000214761
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Ube4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ube4a APN 9 44948141 missense probably damaging 1.00
IGL00857:Ube4a APN 9 44932386 missense probably damaging 1.00
IGL01067:Ube4a APN 9 44944865 missense probably damaging 0.96
White_way UTSW 9 44949753 nonsense probably null
R0243:Ube4a UTSW 9 44946178 unclassified probably benign
R0355:Ube4a UTSW 9 44944801 splice site probably benign
R0680:Ube4a UTSW 9 44948060 missense probably damaging 1.00
R0863:Ube4a UTSW 9 44949816 missense possibly damaging 0.55
R0909:Ube4a UTSW 9 44939973 missense probably damaging 0.97
R1597:Ube4a UTSW 9 44929766 missense possibly damaging 0.93
R1611:Ube4a UTSW 9 44956737 intron probably benign
R1871:Ube4a UTSW 9 44944937 splice site probably null
R2069:Ube4a UTSW 9 44948099 missense probably damaging 0.96
R2518:Ube4a UTSW 9 44948137 missense probably benign 0.29
R3079:Ube4a UTSW 9 44960073 missense probably damaging 1.00
R3404:Ube4a UTSW 9 44929687 missense probably damaging 1.00
R3726:Ube4a UTSW 9 44933323 missense probably damaging 0.97
R3758:Ube4a UTSW 9 44949900 unclassified probably benign
R4027:Ube4a UTSW 9 44949900 unclassified probably benign
R4029:Ube4a UTSW 9 44949900 unclassified probably benign
R4111:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4238:Ube4a UTSW 9 44939999 missense probably damaging 1.00
R4365:Ube4a UTSW 9 44960081 missense probably damaging 1.00
R4471:Ube4a UTSW 9 44946532 unclassified probably benign
R4793:Ube4a UTSW 9 44948822 missense probably damaging 1.00
R5069:Ube4a UTSW 9 44940089 missense probably damaging 1.00
R5214:Ube4a UTSW 9 44948868 missense probably benign 0.22
R5225:Ube4a UTSW 9 44939960 critical splice donor site probably null
R5416:Ube4a UTSW 9 44941178 missense probably damaging 0.99
R5641:Ube4a UTSW 9 44950881 missense probably damaging 0.99
R5729:Ube4a UTSW 9 44933329 missense probably damaging 1.00
R5774:Ube4a UTSW 9 44953097 missense probably damaging 0.99
R5908:Ube4a UTSW 9 44948024 critical splice donor site probably null
R6191:Ube4a UTSW 9 44949753 nonsense probably null
R6752:Ube4a UTSW 9 44925948 missense probably damaging 1.00
R6886:Ube4a UTSW 9 44948843 missense probably damaging 0.96
R6911:Ube4a UTSW 9 44942758 missense probably damaging 1.00
R7417:Ube4a UTSW 9 44956713 missense probably benign 0.08
R7650:Ube4a UTSW 9 44933436 missense probably damaging 0.99
R7747:Ube4a UTSW 9 44925973 missense probably damaging 1.00
R7798:Ube4a UTSW 9 44933331 missense probably damaging 1.00
R7842:Ube4a UTSW 9 44949727 splice site probably null
R7853:Ube4a UTSW 9 44953010 missense probably benign 0.43
R8109:Ube4a UTSW 9 44935483 missense probably benign 0.00
R8223:Ube4a UTSW 9 44960035 missense possibly damaging 0.94
R8401:Ube4a UTSW 9 44941229 missense possibly damaging 0.84
R8523:Ube4a UTSW 9 44949832 missense probably damaging 1.00
X0025:Ube4a UTSW 9 44942818 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AATGCTTTGAGACCTACCTTGG -3'
(R):5'- CTGGTCAGCAGTAGTGGAAC -3'

Sequencing Primer
(F):5'- GAGACCTACCTTGGCCATATC -3'
(R):5'- AGCTGAGCAAGTCTTCAGTTCAGTC -3'
Posted On2015-05-14