Incidental Mutation 'R4113:Eya4'
ID314508
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23155951 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 235 (S235Y)
Ref Sequence ENSEMBL: ENSMUSP00000090335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000218049] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074366
AA Change: S235Y

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: S235Y

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000092665
AA Change: S235Y

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: S235Y

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000218049
Predicted Effect possibly damaging
Transcript: ENSMUST00000219315
AA Change: S258Y

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220299
AA Change: S235Y

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3029:Eya4 UTSW 10 23123878 missense probably benign
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R4894:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5547:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7169:Eya4 UTSW 10 23155947 missense probably benign 0.42
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7549:Eya4 UTSW 10 23111658 missense probably damaging 1.00
R7791:Eya4 UTSW 10 23113926 missense probably damaging 1.00
R7793:Eya4 UTSW 10 23226816 missense probably benign
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCAGAAGTGTACCAAGGAAG -3'
(R):5'- AGCACTGATTTCTTGAGTTGCC -3'

Sequencing Primer
(F):5'- TACCAAGGAAGAGAGAGGGTTTTAC -3'
(R):5'- GCCTGCATTCTTCACATAATGGAG -3'
Posted On2015-05-14