Incidental Mutation 'R4113:Dnajb12'
ID314509
Institutional Source Beutler Lab
Gene Symbol Dnajb12
Ensembl Gene ENSMUSG00000020109
Gene NameDnaJ heat shock protein family (Hsp40) member B12
SynonymsmDj10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4113 (G1)
Quality Score185
Status Not validated
Chromosome10
Chromosomal Location59879556-59899302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59894314 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 270 (S270R)
Ref Sequence ENSEMBL: ENSMUSP00000116577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020309] [ENSMUST00000131810] [ENSMUST00000142819] [ENSMUST00000146590] [ENSMUST00000147914]
Predicted Effect probably benign
Transcript: ENSMUST00000020309
AA Change: S270R

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020309
Gene: ENSMUSG00000020109
AA Change: S270R

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131810
SMART Domains Protein: ENSMUSP00000116244
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
SCOP:d1a17__ 2 40 4e-3 SMART
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142819
AA Change: S270R

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118088
Gene: ENSMUSG00000020109
AA Change: S270R

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146590
AA Change: S270R

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122056
Gene: ENSMUSG00000020109
AA Change: S270R

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147914
AA Change: S270R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116577
Gene: ENSMUSG00000020109
AA Change: S270R

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 263 369 9.2e-31 PFAM
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Dnajb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Dnajb12 APN 10 59892863 splice site probably null
IGL03412:Dnajb12 APN 10 59890073 missense probably benign 0.44
PIT4382001:Dnajb12 UTSW 10 59892686 missense probably damaging 1.00
R0496:Dnajb12 UTSW 10 59879801 nonsense probably null
R1692:Dnajb12 UTSW 10 59896377 missense probably damaging 1.00
R2087:Dnajb12 UTSW 10 59890845 missense possibly damaging 0.82
R2276:Dnajb12 UTSW 10 59892977 missense probably benign 0.31
R4110:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4365:Dnajb12 UTSW 10 59879766 missense probably damaging 1.00
R4382:Dnajb12 UTSW 10 59897499 missense probably benign
R4757:Dnajb12 UTSW 10 59892770 missense probably benign
R5156:Dnajb12 UTSW 10 59892960 missense probably damaging 1.00
R5455:Dnajb12 UTSW 10 59892752 frame shift probably null
R5484:Dnajb12 UTSW 10 59892752 frame shift probably null
R5486:Dnajb12 UTSW 10 59892752 frame shift probably null
R5487:Dnajb12 UTSW 10 59892752 frame shift probably null
R5504:Dnajb12 UTSW 10 59892752 frame shift probably null
R5506:Dnajb12 UTSW 10 59892752 frame shift probably null
R5507:Dnajb12 UTSW 10 59892752 frame shift probably null
R5560:Dnajb12 UTSW 10 59892752 frame shift probably null
R5561:Dnajb12 UTSW 10 59892752 frame shift probably null
R5601:Dnajb12 UTSW 10 59892752 frame shift probably null
R5603:Dnajb12 UTSW 10 59892752 frame shift probably null
R5604:Dnajb12 UTSW 10 59892752 frame shift probably null
R6013:Dnajb12 UTSW 10 59894341 critical splice donor site probably null
R6724:Dnajb12 UTSW 10 59892780 missense possibly damaging 0.92
R6935:Dnajb12 UTSW 10 59896503 critical splice donor site probably null
R8044:Dnajb12 UTSW 10 59896350 missense possibly damaging 0.88
R8073:Dnajb12 UTSW 10 59890179 nonsense probably null
X0022:Dnajb12 UTSW 10 59892976 missense probably null 0.00
Z1088:Dnajb12 UTSW 10 59890054 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTGTCCTCTGGGAAAGCTGTC -3'
(R):5'- GGGAGTCACGCTTCTGAAATC -3'

Sequencing Primer
(F):5'- CCTCTGGGAAAGCTGTCAGAGG -3'
(R):5'- ACGCTTCTGAAATCGCGTAG -3'
Posted On2015-05-14