Mutagenetix > Incidental Mutation

Incidental Mutation 'R4113:Ccdc88c'

314513

Institutional Source

Beutler Lab

Gene Symbol

Ccdc88c

Ensembl Gene

ENSMUSG00000021182

Gene Name

coiled-coil domain containing 88C

Synonyms

0610010D24Rik, Daple

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100911523-101029056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100945073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 34 (L34P)

Ref Sequence

ENSEMBL: ENSMUSP00000152316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096] [ENSMUST00000223235]

AlphaFold

Q6VGS5

Predicted Effect

probably damaging
Transcript: ENSMUST00000068411
AA Change: L834P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: L834P

Domain	Start	End	E-Value	Type
Pfam:HOOK	7	586	5.9e-37	PFAM
low complexity region	601	613	N/A	INTRINSIC
low complexity region	617	634	N/A	INTRINSIC
Blast:BRLZ	668	719	3e-8	BLAST
low complexity region	724	744	N/A	INTRINSIC
low complexity region	827	837	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
Blast:BRLZ	948	1007	6e-15	BLAST
coiled coil region	1035	1085	N/A	INTRINSIC
low complexity region	1095	1110	N/A	INTRINSIC
coiled coil region	1129	1252	N/A	INTRINSIC
coiled coil region	1312	1384	N/A	INTRINSIC
low complexity region	1430	1439	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
low complexity region	1698	1709	N/A	INTRINSIC
internal_repeat_1	1721	1778	6.97e-6	PROSPERO
low complexity region	1788	1808	N/A	INTRINSIC
internal_repeat_1	1934	1989	6.97e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000085096
AA Change: L841P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: L841P

Domain	Start	End	E-Value	Type
Pfam:HOOK	13	597	2.5e-41	PFAM
low complexity region	608	620	N/A	INTRINSIC
low complexity region	624	641	N/A	INTRINSIC
Blast:BRLZ	675	726	3e-8	BLAST
low complexity region	731	751	N/A	INTRINSIC
low complexity region	834	844	N/A	INTRINSIC
low complexity region	854	873	N/A	INTRINSIC
Blast:BRLZ	955	1014	5e-15	BLAST
coiled coil region	1042	1092	N/A	INTRINSIC
low complexity region	1102	1117	N/A	INTRINSIC
coiled coil region	1136	1259	N/A	INTRINSIC
coiled coil region	1319	1391	N/A	INTRINSIC
low complexity region	1437	1446	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1569	1590	N/A	INTRINSIC
low complexity region	1705	1716	N/A	INTRINSIC
internal_repeat_1	1728	1785	6.57e-6	PROSPERO
low complexity region	1795	1815	N/A	INTRINSIC
internal_repeat_1	1941	1996	6.57e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221309

Predicted Effect

probably damaging
Transcript: ENSMUST00000223235
AA Change: L34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.3125

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bace2	A	G	16: 97,436,656	T436A	probably benign	Het
BC024139	A	G	15: 76,121,627	M458T	probably benign	Het
Casp2	G	A	6: 42,267,894	A76T	probably damaging	Het
Catsper3	A	G	13: 55,786,370	K35E	probably damaging	Het
Dcaf13	T	A	15: 39,130,220	I236N	probably damaging	Het
Dip2c	G	T	13: 9,637,101	G1254C	probably damaging	Het
Dnah12	T	C	14: 26,693,567	L41P	probably damaging	Het
Dnah17	T	C	11: 118,112,594	K514R	possibly damaging	Het
Dnajb12	T	A	10: 59,894,314	S270R	possibly damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Eya4	G	T	10: 23,155,951	S235Y	probably damaging	Het
Fam208a	C	T	14: 27,459,961	R483*	probably null	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gdf3	A	G	6: 122,607,057	I117T	probably damaging	Het
Gm5611	T	A	9: 17,030,693		noncoding transcript	Het
Gtf3c4	G	A	2: 28,827,555	T771I	probably damaging	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Hyls1	T	A	9: 35,561,418	Y234F	probably damaging	Het
Irak1bp1	T	C	9: 82,846,675	S220P	probably benign	Het
Lama1	G	A	17: 67,764,703	V862I	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Olfr1271	A	T	2: 90,266,340	L30H	probably damaging	Het
Olfr304	G	A	7: 86,386,525	T45M	possibly damaging	Het
Pcdh8	T	C	14: 79,767,513	D927G	probably damaging	Het
Prelid3a	T	C	18: 67,472,897	Y25H	probably damaging	Het
Ptprm	T	C	17: 66,725,813	D1015G	probably damaging	Het
Rhox3f	G	T	X: 37,582,019	E140*	probably null	Het
Riox2	C	T	16: 59,491,894	L465F	probably benign	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Stab1	C	T	14: 31,168,479	R5Q	probably damaging	Het
Stmn3	T	C	2: 181,307,296	K135E	possibly damaging	Het
Synj2	G	A	17: 6,007,965	G243S	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tshz2	C	A	2: 169,885,530	P213Q	probably benign	Het
Tssk4	A	G	14: 55,650,373	T9A	probably benign	Het
Ube4a	T	A	9: 44,948,949	I272F	probably damaging	Het
Unc79	T	C	12: 103,059,370	C339R	probably damaging	Het
Vmn2r87	T	C	10: 130,479,822	D125G	probably benign	Het
Yap1	A	T	9: 7,938,431	*358K	probably null	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Ccdc88c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01112:Ccdc88c	APN	12	100916803	missense	probably benign	0.04
IGL02016:Ccdc88c	APN	12	100941207	missense	possibly damaging	0.63
IGL02031:Ccdc88c	APN	12	100933311	missense	probably damaging	0.98
IGL02133:Ccdc88c	APN	12	100940090	missense	probably damaging	1.00
IGL02427:Ccdc88c	APN	12	100921592	missense	probably damaging	1.00
IGL02494:Ccdc88c	APN	12	100945475	missense	probably benign
IGL02496:Ccdc88c	APN	12	100953293	missense	probably benign	0.05
IGL02549:Ccdc88c	APN	12	100928932	missense	probably benign	0.18
IGL02618:Ccdc88c	APN	12	100913553	missense	probably benign	0.28
IGL02626:Ccdc88c	APN	12	100967800	unclassified	probably benign
IGL03142:Ccdc88c	APN	12	100947198	missense	probably damaging	1.00
BB010:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
BB020:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R0127:Ccdc88c	UTSW	12	100935740	missense	possibly damaging	0.88
R0533:Ccdc88c	UTSW	12	100954282	missense	probably damaging	1.00
R0545:Ccdc88c	UTSW	12	100947188	missense	probably damaging	1.00
R0866:Ccdc88c	UTSW	12	100913192	missense	probably benign	0.01
R1230:Ccdc88c	UTSW	12	100948488	missense	probably benign	0.00
R1434:Ccdc88c	UTSW	12	100939166	splice site	probably benign
R1614:Ccdc88c	UTSW	12	100912984	missense	probably benign	0.00
R1644:Ccdc88c	UTSW	12	100913474	missense	probably damaging	0.98
R1712:Ccdc88c	UTSW	12	100939025	missense	probably benign	0.14
R2107:Ccdc88c	UTSW	12	100921549	missense	probably benign
R3612:Ccdc88c	UTSW	12	100939073	missense	probably damaging	0.99
R3724:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3737:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R3743:Ccdc88c	UTSW	12	100948584	missense	probably damaging	1.00
R3772:Ccdc88c	UTSW	12	100966100	unclassified	probably benign
R3776:Ccdc88c	UTSW	12	100947179	missense	probably damaging	0.97
R3917:Ccdc88c	UTSW	12	100941107	critical splice donor site	probably null
R4034:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4035:Ccdc88c	UTSW	12	100930524	missense	possibly damaging	0.80
R4110:Ccdc88c	UTSW	12	100945073	missense	probably damaging	1.00
R4270:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4271:Ccdc88c	UTSW	12	100947219	missense	probably damaging	1.00
R4520:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4521:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4522:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4523:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4524:Ccdc88c	UTSW	12	100913332	missense	possibly damaging	0.48
R4717:Ccdc88c	UTSW	12	100916666	missense	probably benign	0.00
R4821:Ccdc88c	UTSW	12	100938079	missense	probably benign	0.00
R4823:Ccdc88c	UTSW	12	100930543	missense	probably damaging	1.00
R5090:Ccdc88c	UTSW	12	100954180	missense	probably damaging	1.00
R5510:Ccdc88c	UTSW	12	100945031	missense	probably damaging	1.00
R5514:Ccdc88c	UTSW	12	100913439	missense	probably damaging	1.00
R5903:Ccdc88c	UTSW	12	100930542	missense	probably damaging	1.00
R5999:Ccdc88c	UTSW	12	100968354	missense	probably damaging	1.00
R6131:Ccdc88c	UTSW	12	100941128	missense	probably damaging	1.00
R6164:Ccdc88c	UTSW	12	100953383	missense	probably damaging	0.98
R6971:Ccdc88c	UTSW	12	100954227	missense	probably damaging	1.00
R6998:Ccdc88c	UTSW	12	100916852	missense	probably damaging	0.96
R7031:Ccdc88c	UTSW	12	100945064	missense	probably damaging	1.00
R7240:Ccdc88c	UTSW	12	100944939	missense	probably benign	0.17
R7366:Ccdc88c	UTSW	12	100944950	missense	possibly damaging	0.89
R7604:Ccdc88c	UTSW	12	100930547	missense	probably damaging	1.00
R7674:Ccdc88c	UTSW	12	100945232	missense	probably benign	0.00
R7795:Ccdc88c	UTSW	12	100923311	missense	probably benign	0.32
R7933:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R7990:Ccdc88c	UTSW	12	100967985	missense	probably damaging	1.00
R8339:Ccdc88c	UTSW	12	100941140	nonsense	probably null
R8734:Ccdc88c	UTSW	12	100940135	missense	probably damaging	1.00
R8778:Ccdc88c	UTSW	12	100945224	missense	probably benign	0.25
R8925:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R8927:Ccdc88c	UTSW	12	100966417	missense	possibly damaging	0.55
R9014:Ccdc88c	UTSW	12	100913064	missense	probably benign	0.09
R9204:Ccdc88c	UTSW	12	100938063	missense	unknown
R9257:Ccdc88c	UTSW	12	100923215	missense	possibly damaging	0.94
R9326:Ccdc88c	UTSW	12	101028850	start gained	probably benign
R9424:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
R9439:Ccdc88c	UTSW	12	100918338	missense	probably benign	0.25
R9539:Ccdc88c	UTSW	12	100935734	missense	possibly damaging	0.89
R9576:Ccdc88c	UTSW	12	100945490	missense	possibly damaging	0.93
Z1176:Ccdc88c	UTSW	12	100945770	missense	possibly damaging	0.69
Z1177:Ccdc88c	UTSW	12	100945155	missense	probably benign
Z1190:Ccdc88c	UTSW	12	100923332	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CATGTTGCCATTGCCCAACC -3'
(R):5'- CCTTGAGCAAGAAGTCGGAG -3'

Sequencing Primer
(F):5'- ATTGCCCAACCTCGAGGCTC -3'
(R):5'- TGCAGCACAGCTTGGAG -3'

Posted On

2015-05-14