Mutagenetix > Incidental Mutation

Incidental Mutation 'R4113:Tssk4'

314520

Institutional Source

Beutler Lab

Gene Symbol

Tssk4

Ensembl Gene

ENSMUSG00000007591

Gene Name

testis-specific serine kinase 4

Synonyms

1700020B19Rik, 4933424F08Rik

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.747) question?

Stock #

R4113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55650184-55652539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55650373 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 9 (T9A)

Ref Sequence

ENSEMBL: ENSMUSP00000154143 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007735] [ENSMUST00000164809] [ENSMUST00000226497] [ENSMUST00000226591] [ENSMUST00000227297] [ENSMUST00000228041] [ENSMUST00000228395]

AlphaFold

Q9D411

Predicted Effect

probably benign
Transcript: ENSMUST00000007735
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000007735
Gene: ENSMUSG00000007591
AA Change: T9A

Domain	Start	End	E-Value	Type
Pfam:Pkinase	25	280	1.1e-54	PFAM
Pfam:Pkinase_Tyr	25	280	7.9e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164809
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000127728
Gene: ENSMUSG00000007591
AA Change: T9A

Domain	Start	End	E-Value	Type
Pfam:Pkinase	25	281	4e-56	PFAM
Pfam:Pkinase_Tyr	25	281	3.3e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226497
AA Change: T9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000226591
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000227297
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228007

Predicted Effect

probably benign
Transcript: ENSMUST00000228041
AA Change: T9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000228395
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the testis-specific serine/threonine kinase family. The encoded protein is thought to be involved in spermatogenesis via stimulation of the CREB/CRE responsive pathway through phosphorylation of the cAMP responsive element binding protein transcription factor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bace2	A	G	16: 97,436,656	T436A	probably benign	Het
BC024139	A	G	15: 76,121,627	M458T	probably benign	Het
Casp2	G	A	6: 42,267,894	A76T	probably damaging	Het
Catsper3	A	G	13: 55,786,370	K35E	probably damaging	Het
Ccdc88c	A	G	12: 100,945,073	L34P	probably damaging	Het
Dcaf13	T	A	15: 39,130,220	I236N	probably damaging	Het
Dip2c	G	T	13: 9,637,101	G1254C	probably damaging	Het
Dnah12	T	C	14: 26,693,567	L41P	probably damaging	Het
Dnah17	T	C	11: 118,112,594	K514R	possibly damaging	Het
Dnajb12	T	A	10: 59,894,314	S270R	possibly damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Eya4	G	T	10: 23,155,951	S235Y	probably damaging	Het
Fam208a	C	T	14: 27,459,961	R483*	probably null	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gdf3	A	G	6: 122,607,057	I117T	probably damaging	Het
Gm5611	T	A	9: 17,030,693		noncoding transcript	Het
Gtf3c4	G	A	2: 28,827,555	T771I	probably damaging	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Hyls1	T	A	9: 35,561,418	Y234F	probably damaging	Het
Irak1bp1	T	C	9: 82,846,675	S220P	probably benign	Het
Lama1	G	A	17: 67,764,703	V862I	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Olfr1271	A	T	2: 90,266,340	L30H	probably damaging	Het
Olfr304	G	A	7: 86,386,525	T45M	possibly damaging	Het
Pcdh8	T	C	14: 79,767,513	D927G	probably damaging	Het
Prelid3a	T	C	18: 67,472,897	Y25H	probably damaging	Het
Ptprm	T	C	17: 66,725,813	D1015G	probably damaging	Het
Rhox3f	G	T	X: 37,582,019	E140*	probably null	Het
Riox2	C	T	16: 59,491,894	L465F	probably benign	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Stab1	C	T	14: 31,168,479	R5Q	probably damaging	Het
Stmn3	T	C	2: 181,307,296	K135E	possibly damaging	Het
Synj2	G	A	17: 6,007,965	G243S	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tshz2	C	A	2: 169,885,530	P213Q	probably benign	Het
Ube4a	T	A	9: 44,948,949	I272F	probably damaging	Het
Unc79	T	C	12: 103,059,370	C339R	probably damaging	Het
Vmn2r87	T	C	10: 130,479,822	D125G	probably benign	Het
Yap1	A	T	9: 7,938,431	*358K	probably null	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Tssk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01627:Tssk4	APN	14	55650553	missense	probably damaging	1.00
IGL02943:Tssk4	APN	14	55651566	missense	probably damaging	1.00
IGL03082:Tssk4	APN	14	55651061	missense	probably damaging	1.00
IGL03281:Tssk4	APN	14	55650428	missense	possibly damaging	0.86
R0201:Tssk4	UTSW	14	55651559	nonsense	probably null
R0201:Tssk4	UTSW	14	55651560	missense	probably damaging	1.00
R1655:Tssk4	UTSW	14	55651695	missense	probably damaging	1.00
R1660:Tssk4	UTSW	14	55650572	missense	probably null	0.90
R1743:Tssk4	UTSW	14	55651031	missense	probably damaging	1.00
R2103:Tssk4	UTSW	14	55651540	missense	probably damaging	1.00
R3431:Tssk4	UTSW	14	55651695	missense	probably damaging	1.00
R3432:Tssk4	UTSW	14	55651695	missense	probably damaging	1.00
R4870:Tssk4	UTSW	14	55651815	missense	probably benign	0.38
R4957:Tssk4	UTSW	14	55651809	missense	probably damaging	1.00
R5147:Tssk4	UTSW	14	55650973	missense	possibly damaging	0.56
R6785:Tssk4	UTSW	14	55650475	missense	probably damaging	1.00
R6917:Tssk4	UTSW	14	55652407	missense	probably benign	0.13
R7748:Tssk4	UTSW	14	55651112	missense	probably damaging	1.00
R9043:Tssk4	UTSW	14	55651754	missense	probably damaging	0.99
R9189:Tssk4	UTSW	14	55650447	missense	probably benign	0.00
Z1088:Tssk4	UTSW	14	55650923	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAAGTTCTTAGTGAAGGGC -3'
(R):5'- TTCTGACCTGTATCTCACGTGG -3'

Sequencing Primer
(F):5'- TCTTAGTGAAGGGCCGAGC -3'
(R):5'- ACCTGTATCTCACGTGGTAGGAAC -3'

Posted On

2015-05-14