Incidental Mutation 'R4113:Dcaf13'
ID314522
Institutional Source Beutler Lab
Gene Symbol Dcaf13
Ensembl Gene ENSMUSG00000022300
Gene NameDDB1 and CUL4 associated factor 13
SynonymsLOC223499, Wdsof1
Accession Numbers

Genbank: NM_198606; MGI: 2684929

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location39112865-39146856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39130220 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 236 (I236N)
Ref Sequence ENSEMBL: ENSMUSP00000022909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022909]
Predicted Effect probably damaging
Transcript: ENSMUST00000022909
AA Change: I236N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022909
Gene: ENSMUSG00000022300
AA Change: I236N

DomainStartEndE-ValueType
WD40 55 95 5.77e-5 SMART
WD40 98 137 4.38e-5 SMART
WD40 185 225 5.97e-1 SMART
Blast:WD40 228 267 1e-18 BLAST
WD40 271 310 2.69e-5 SMART
WD40 312 353 2.96e-2 SMART
Pfam:Sof1 354 440 7.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228436
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Dcaf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Dcaf13 APN 15 39143632 nonsense probably null
IGL01081:Dcaf13 APN 15 39118806 missense probably damaging 1.00
IGL01766:Dcaf13 APN 15 39118750 missense probably benign 0.00
IGL02174:Dcaf13 APN 15 39138149 missense probably damaging 1.00
IGL02262:Dcaf13 APN 15 39118707 splice site probably benign
IGL02740:Dcaf13 APN 15 39145100 nonsense probably null
IGL03092:Dcaf13 APN 15 39127976 splice site probably benign
IGL03374:Dcaf13 APN 15 39145148 nonsense probably null
R0590:Dcaf13 UTSW 15 39145085 splice site probably benign
R0594:Dcaf13 UTSW 15 39123268 missense probably benign 0.00
R0711:Dcaf13 UTSW 15 39138089 missense probably damaging 1.00
R1036:Dcaf13 UTSW 15 39143718 missense probably damaging 1.00
R1770:Dcaf13 UTSW 15 39130238 missense probably damaging 1.00
R1826:Dcaf13 UTSW 15 39118899 missense probably damaging 1.00
R1933:Dcaf13 UTSW 15 39138088 missense probably damaging 0.99
R2508:Dcaf13 UTSW 15 39145152 missense probably benign
R4595:Dcaf13 UTSW 15 39118893 missense probably damaging 1.00
R4649:Dcaf13 UTSW 15 39138242 missense possibly damaging 0.54
R5431:Dcaf13 UTSW 15 39123224 missense probably benign 0.16
R5454:Dcaf13 UTSW 15 39124364 missense probably benign
R5834:Dcaf13 UTSW 15 39143642 nonsense probably null
R5929:Dcaf13 UTSW 15 39143653 missense possibly damaging 0.89
R5944:Dcaf13 UTSW 15 39146677 missense probably benign
R6319:Dcaf13 UTSW 15 39143672 missense probably benign 0.00
R6394:Dcaf13 UTSW 15 39143737 missense probably benign 0.04
R6664:Dcaf13 UTSW 15 39118888 missense probably damaging 1.00
R6884:Dcaf13 UTSW 15 39123240 missense probably damaging 1.00
R7419:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
Z1088:Dcaf13 UTSW 15 39145247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACAGTGTCTTTCTCAGAGAAC -3'
(R):5'- CAAAGGGCTCATCACAGGTG -3'

Sequencing Primer
(F):5'- GTCTTTCTCAGAGAACAGTCACTGAC -3'
(R):5'- GCTCATCACAGGTGGCAGTTTAC -3'
Posted On2015-05-14