Mutagenetix > Incidental Mutation

Incidental Mutation 'R4113:Dcaf13'

314522

Institutional Source

Beutler Lab

Gene Symbol

Dcaf13

Ensembl Gene

ENSMUSG00000022300

Gene Name

DDB1 and CUL4 associated factor 13

Synonyms

LOC223499, Wdsof1

Accession Numbers

Genbank: NM_198606; MGI: 2684929

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R4113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39112865-39146856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 39130220 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 236 (I236N)

Ref Sequence

ENSEMBL: ENSMUSP00000022909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022909]

AlphaFold

Q6PAC3

Predicted Effect

probably damaging
Transcript: ENSMUST00000022909
AA Change: I236N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000022909
Gene: ENSMUSG00000022300
AA Change: I236N

Domain	Start	End	E-Value	Type
WD40	55	95	5.77e-5	SMART
WD40	98	137	4.38e-5	SMART
WD40	185	225	5.97e-1	SMART
Blast:WD40	228	267	1e-18	BLAST
WD40	271	310	2.69e-5	SMART
WD40	312	353	2.96e-2	SMART
Pfam:Sof1	354	440	7.2e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226224

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228436

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.6%
20x: 96.1%

Validation Efficiency

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bace2	A	G	16: 97,436,656	T436A	probably benign	Het
BC024139	A	G	15: 76,121,627	M458T	probably benign	Het
Casp2	G	A	6: 42,267,894	A76T	probably damaging	Het
Catsper3	A	G	13: 55,786,370	K35E	probably damaging	Het
Ccdc88c	A	G	12: 100,945,073	L34P	probably damaging	Het
Dip2c	G	T	13: 9,637,101	G1254C	probably damaging	Het
Dnah12	T	C	14: 26,693,567	L41P	probably damaging	Het
Dnah17	T	C	11: 118,112,594	K514R	possibly damaging	Het
Dnajb12	T	A	10: 59,894,314	S270R	possibly damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Eya4	G	T	10: 23,155,951	S235Y	probably damaging	Het
Fam208a	C	T	14: 27,459,961	R483*	probably null	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gdf3	A	G	6: 122,607,057	I117T	probably damaging	Het
Gm5611	T	A	9: 17,030,693		noncoding transcript	Het
Gtf3c4	G	A	2: 28,827,555	T771I	probably damaging	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Hyls1	T	A	9: 35,561,418	Y234F	probably damaging	Het
Irak1bp1	T	C	9: 82,846,675	S220P	probably benign	Het
Lama1	G	A	17: 67,764,703	V862I	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Olfr1271	A	T	2: 90,266,340	L30H	probably damaging	Het
Olfr304	G	A	7: 86,386,525	T45M	possibly damaging	Het
Pcdh8	T	C	14: 79,767,513	D927G	probably damaging	Het
Prelid3a	T	C	18: 67,472,897	Y25H	probably damaging	Het
Ptprm	T	C	17: 66,725,813	D1015G	probably damaging	Het
Rhox3f	G	T	X: 37,582,019	E140*	probably null	Het
Riox2	C	T	16: 59,491,894	L465F	probably benign	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Stab1	C	T	14: 31,168,479	R5Q	probably damaging	Het
Stmn3	T	C	2: 181,307,296	K135E	possibly damaging	Het
Synj2	G	A	17: 6,007,965	G243S	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tshz2	C	A	2: 169,885,530	P213Q	probably benign	Het
Tssk4	A	G	14: 55,650,373	T9A	probably benign	Het
Ube4a	T	A	9: 44,948,949	I272F	probably damaging	Het
Unc79	T	C	12: 103,059,370	C339R	probably damaging	Het
Vmn2r87	T	C	10: 130,479,822	D125G	probably benign	Het
Yap1	A	T	9: 7,938,431	*358K	probably null	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Dcaf13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Dcaf13	APN	15	39143632	nonsense	probably null
IGL01081:Dcaf13	APN	15	39118806	missense	probably damaging	1.00
IGL01766:Dcaf13	APN	15	39118750	missense	probably benign	0.00
IGL02174:Dcaf13	APN	15	39138149	missense	probably damaging	1.00
IGL02262:Dcaf13	APN	15	39118707	splice site	probably benign
IGL02740:Dcaf13	APN	15	39145100	nonsense	probably null
IGL03092:Dcaf13	APN	15	39127976	splice site	probably benign
IGL03374:Dcaf13	APN	15	39145148	nonsense	probably null
R0590:Dcaf13	UTSW	15	39145085	splice site	probably benign
R0594:Dcaf13	UTSW	15	39123268	missense	probably benign	0.00
R0711:Dcaf13	UTSW	15	39138089	missense	probably damaging	1.00
R1036:Dcaf13	UTSW	15	39143718	missense	probably damaging	1.00
R1770:Dcaf13	UTSW	15	39130238	missense	probably damaging	1.00
R1826:Dcaf13	UTSW	15	39118899	missense	probably damaging	1.00
R1933:Dcaf13	UTSW	15	39138088	missense	probably damaging	0.99
R2508:Dcaf13	UTSW	15	39145152	missense	probably benign
R4595:Dcaf13	UTSW	15	39118893	missense	probably damaging	1.00
R4649:Dcaf13	UTSW	15	39138242	missense	possibly damaging	0.54
R5431:Dcaf13	UTSW	15	39123224	missense	probably benign	0.16
R5454:Dcaf13	UTSW	15	39124364	missense	probably benign
R5834:Dcaf13	UTSW	15	39143642	nonsense	probably null
R5929:Dcaf13	UTSW	15	39143653	missense	possibly damaging	0.89
R5944:Dcaf13	UTSW	15	39146677	missense	probably benign
R6319:Dcaf13	UTSW	15	39143672	missense	probably benign	0.00
R6394:Dcaf13	UTSW	15	39143737	missense	probably benign	0.04
R6664:Dcaf13	UTSW	15	39118888	missense	probably damaging	1.00
R6884:Dcaf13	UTSW	15	39123240	missense	probably damaging	1.00
R7419:Dcaf13	UTSW	15	39130220	missense	probably damaging	0.98
R8750:Dcaf13	UTSW	15	39119441	missense	probably damaging	1.00
R8944:Dcaf13	UTSW	15	39138217	missense	possibly damaging	0.79
R9294:Dcaf13	UTSW	15	39130292	missense	possibly damaging	0.92
R9300:Dcaf13	UTSW	15	39146707	missense	probably damaging	1.00
R9663:Dcaf13	UTSW	15	39118783	missense	possibly damaging	0.88
R9696:Dcaf13	UTSW	15	39138101	missense	possibly damaging	0.80
R9778:Dcaf13	UTSW	15	39145191	missense	probably damaging	0.99
Z1088:Dcaf13	UTSW	15	39145247	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTACAGTGTCTTTCTCAGAGAAC -3'
(R):5'- CAAAGGGCTCATCACAGGTG -3'

Sequencing Primer
(F):5'- GTCTTTCTCAGAGAACAGTCACTGAC -3'
(R):5'- GCTCATCACAGGTGGCAGTTTAC -3'

Posted On

2015-05-14