Incidental Mutation 'R4113:Riox2'
ID314525
Institutional Source Beutler Lab
Gene Symbol Riox2
Ensembl Gene ENSMUSG00000022724
Gene Nameribosomal oxygenase 2
Synonyms3830408E23Rik, 1810047J07Rik, Mina, 2410057H13Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59471775-59492461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59491894 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 465 (L465F)
Ref Sequence ENSEMBL: ENSMUSP00000125297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023407] [ENSMUST00000044604] [ENSMUST00000120674] [ENSMUST00000160571] [ENSMUST00000172910]
Predicted Effect probably benign
Transcript: ENSMUST00000023407
AA Change: L465F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023407
Gene: ENSMUSG00000022724
AA Change: L465F

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044604
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120674
SMART Domains Protein: ENSMUSP00000112899
Gene: ENSMUSG00000022724

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131272
Predicted Effect probably benign
Transcript: ENSMUST00000160571
AA Change: L465F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125297
Gene: ENSMUSG00000022724
AA Change: L465F

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172910
Predicted Effect probably benign
Transcript: ENSMUST00000232544
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MINA is a c-Myc (MYC; MIM 190080) target gene that may play a role in cell proliferation or regulation of cell growth. (Tsuneoka et al., 2002 [PubMed 12091391]; Zhang et al., 2005 [PubMed 15897898]).[supplied by OMIM, May 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced allergic response to house dust mites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Riox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Riox2 APN 16 59489417 missense probably benign 0.03
IGL02580:Riox2 APN 16 59486573 missense probably benign 0.00
IGL03076:Riox2 APN 16 59491212 missense possibly damaging 0.68
R0009:Riox2 UTSW 16 59489367 missense probably benign 0.01
R0009:Riox2 UTSW 16 59489367 missense probably benign 0.01
R0322:Riox2 UTSW 16 59489389 nonsense probably null
R0592:Riox2 UTSW 16 59489579 unclassified probably benign
R0620:Riox2 UTSW 16 59491892 missense probably benign 0.20
R1588:Riox2 UTSW 16 59475583 missense possibly damaging 0.46
R1623:Riox2 UTSW 16 59483042 missense probably damaging 1.00
R2863:Riox2 UTSW 16 59489393 missense probably damaging 0.99
R4468:Riox2 UTSW 16 59475994 intron probably benign
R4708:Riox2 UTSW 16 59475682 missense probably benign 0.00
R4739:Riox2 UTSW 16 59489369 missense probably benign
R5074:Riox2 UTSW 16 59491873 missense possibly damaging 0.59
R5385:Riox2 UTSW 16 59486616 missense probably benign 0.33
R8124:Riox2 UTSW 16 59486591 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTGTGCAAAATCCATGAAGTGAC -3'
(R):5'- TCTGGGATGCCTAATAATTTCCTG -3'

Sequencing Primer
(F):5'- TTGTACTAAACAATGTCTCCTCCTTC -3'
(R):5'- GGATGCCTAATAATTTCCTGGTTTTC -3'
Posted On2015-05-14