Incidental Mutation 'R4113:Dnajc28'
ID314526
Institutional Source Beutler Lab
Gene Symbol Dnajc28
Ensembl Gene ENSMUSG00000039763
Gene NameDnaJ heat shock protein family (Hsp40) member C28
SynonymsORF28
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4113 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91614254-91619026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91616867 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 187 (T187M)
Ref Sequence ENSEMBL: ENSMUSP00000132288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000049244] [ENSMUST00000133731] [ENSMUST00000143058] [ENSMUST00000156713] [ENSMUST00000169982] [ENSMUST00000232289] [ENSMUST00000232640]
Predicted Effect probably benign
Transcript: ENSMUST00000023684
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049244
AA Change: T163M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048113
Gene: ENSMUSG00000039763
AA Change: T163M

DomainStartEndE-ValueType
DnaJ 47 105 1.04e-11 SMART
low complexity region 112 123 N/A INTRINSIC
Pfam:DUF1992 203 342 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133731
SMART Domains Protein: ENSMUSP00000118526
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 47 84 6.65e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138207
Predicted Effect possibly damaging
Transcript: ENSMUST00000143058
AA Change: T187M

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120318
Gene: ENSMUSG00000039763
AA Change: T187M

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169982
AA Change: T187M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132288
Gene: ENSMUSG00000039763
AA Change: T187M

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Pfam:DUF1992 227 295 1.2e-24 PFAM
coiled coil region 312 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232620
Predicted Effect probably benign
Transcript: ENSMUST00000232640
Predicted Effect probably benign
Transcript: ENSMUST00000232643
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DnaJ heat shock protein family. The encoded protein, which contains a conserved N-terminal DnaJ domain, is thought to play a role in protein folding or act as a molecular chaperone protein. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Dnajc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Dnajc28 APN 16 91616441 missense possibly damaging 0.49
R1199:Dnajc28 UTSW 16 91618642 unclassified probably benign
R2265:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2266:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2276:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2277:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2278:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2364:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2366:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2367:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2447:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3757:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3890:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4087:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4088:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4110:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4112:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R6372:Dnajc28 UTSW 16 91617288 missense probably benign 0.36
R6613:Dnajc28 UTSW 16 91616358 nonsense probably null
R8061:Dnajc28 UTSW 16 91617170 missense possibly damaging 0.70
R8163:Dnajc28 UTSW 16 91616907 nonsense probably null
R8165:Dnajc28 UTSW 16 91616907 nonsense probably null
R8172:Dnajc28 UTSW 16 91616907 nonsense probably null
R8174:Dnajc28 UTSW 16 91616907 nonsense probably null
Z1176:Dnajc28 UTSW 16 91617033 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGCCAGAAAATTTCTTCAGCGG -3'
(R):5'- TGTCCCATGCGATAAAACGG -3'

Sequencing Primer
(F):5'- TTTCCCGCTGAGATTGTCAAAG -3'
(R):5'- TGCGATAAAACGGATGCATGCC -3'
Posted On2015-05-14