Mutagenetix > Incidental Mutation

Incidental Mutation 'R4113:Ptprm'

314530

Institutional Source

Beutler Lab

Gene Symbol

Ptprm

Ensembl Gene

ENSMUSG00000033278

Gene Name

protein tyrosine phosphatase, receptor type, M

Synonyms

RPTPmu

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66666947-67354457 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66725813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1015 (D1015G)

Ref Sequence

ENSEMBL: ENSMUSP00000045603 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982]

AlphaFold

P28828

Predicted Effect

probably damaging
Transcript: ENSMUST00000037974
AA Change: D1015G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: D1015G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
MAM	22	184	2.81e-73	SMART
IG	191	279	2.1e-6	SMART
FN3	281	364	6.35e-4	SMART
FN3	380	468	2.81e-5	SMART
FN3	482	572	3.7e-5	SMART
transmembrane domain	743	764	N/A	INTRINSIC
low complexity region	765	774	N/A	INTRINSIC
PTPc	899	1156	5.26e-135	SMART
PTPc	1185	1450	9.46e-96	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223982
AA Change: D981G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bace2	A	G	16: 97,436,656	T436A	probably benign	Het
BC024139	A	G	15: 76,121,627	M458T	probably benign	Het
Casp2	G	A	6: 42,267,894	A76T	probably damaging	Het
Catsper3	A	G	13: 55,786,370	K35E	probably damaging	Het
Ccdc88c	A	G	12: 100,945,073	L34P	probably damaging	Het
Dcaf13	T	A	15: 39,130,220	I236N	probably damaging	Het
Dip2c	G	T	13: 9,637,101	G1254C	probably damaging	Het
Dnah12	T	C	14: 26,693,567	L41P	probably damaging	Het
Dnah17	T	C	11: 118,112,594	K514R	possibly damaging	Het
Dnajb12	T	A	10: 59,894,314	S270R	possibly damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Eya4	G	T	10: 23,155,951	S235Y	probably damaging	Het
Fam208a	C	T	14: 27,459,961	R483*	probably null	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gdf3	A	G	6: 122,607,057	I117T	probably damaging	Het
Gm5611	T	A	9: 17,030,693		noncoding transcript	Het
Gtf3c4	G	A	2: 28,827,555	T771I	probably damaging	Het
Hrh3	C	A	2: 180,102,850	R99L	possibly damaging	Het
Hyls1	T	A	9: 35,561,418	Y234F	probably damaging	Het
Irak1bp1	T	C	9: 82,846,675	S220P	probably benign	Het
Lama1	G	A	17: 67,764,703	V862I	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Olfr1271	A	T	2: 90,266,340	L30H	probably damaging	Het
Olfr304	G	A	7: 86,386,525	T45M	possibly damaging	Het
Pcdh8	T	C	14: 79,767,513	D927G	probably damaging	Het
Prelid3a	T	C	18: 67,472,897	Y25H	probably damaging	Het
Rhox3f	G	T	X: 37,582,019	E140*	probably null	Het
Riox2	C	T	16: 59,491,894	L465F	probably benign	Het
Sec31b	G	T	19: 44,524,529	T507N	possibly damaging	Het
Stab1	C	T	14: 31,168,479	R5Q	probably damaging	Het
Stmn3	T	C	2: 181,307,296	K135E	possibly damaging	Het
Synj2	G	A	17: 6,007,965	G243S	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tshz2	C	A	2: 169,885,530	P213Q	probably benign	Het
Tssk4	A	G	14: 55,650,373	T9A	probably benign	Het
Ube4a	T	A	9: 44,948,949	I272F	probably damaging	Het
Unc79	T	C	12: 103,059,370	C339R	probably damaging	Het
Vmn2r87	T	C	10: 130,479,822	D125G	probably benign	Het
Yap1	A	T	9: 7,938,431	*358K	probably null	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Ptprm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Ptprm	APN	17	66817972	missense	probably damaging	1.00
IGL01128:Ptprm	APN	17	67042101	missense	probably damaging	1.00
IGL01509:Ptprm	APN	17	66762213	missense	possibly damaging	0.95
IGL01785:Ptprm	APN	17	66685623	missense	probably damaging	1.00
IGL01912:Ptprm	APN	17	67046118	missense	probably benign	0.13
IGL01929:Ptprm	APN	17	66690549	missense	probably damaging	1.00
IGL01937:Ptprm	APN	17	67046163	splice site	probably benign
IGL01939:Ptprm	APN	17	67063163	splice site	probably benign
IGL02053:Ptprm	APN	17	66693841	missense	probably damaging	1.00
IGL02203:Ptprm	APN	17	66953123	missense	probably damaging	1.00
IGL02468:Ptprm	APN	17	66814509	missense	probably benign	0.02
IGL02500:Ptprm	APN	17	66920048	missense	probably damaging	0.99
IGL02542:Ptprm	APN	17	66920150	missense	probably benign
Becalming	UTSW	17	66944332	splice site	probably null
Pacifying	UTSW	17	66683408	missense	possibly damaging	0.74
R0674:Ptprm	UTSW	17	67191341	missense	possibly damaging	0.52
R0709:Ptprm	UTSW	17	66944332	splice site	probably null
R1054:Ptprm	UTSW	17	67042318	missense	probably damaging	1.00
R1522:Ptprm	UTSW	17	66693871	missense	possibly damaging	0.91
R1561:Ptprm	UTSW	17	66940541	missense	probably damaging	1.00
R1726:Ptprm	UTSW	17	67042327	missense	probably damaging	1.00
R1744:Ptprm	UTSW	17	66689366	missense	probably damaging	1.00
R1873:Ptprm	UTSW	17	66688355	missense	probably damaging	1.00
R1951:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1952:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1953:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1993:Ptprm	UTSW	17	66747160	missense	probably damaging	1.00
R2017:Ptprm	UTSW	17	66957153	splice site	probably null
R2266:Ptprm	UTSW	17	66725851	splice site	probably null
R2417:Ptprm	UTSW	17	66944326	missense	probably damaging	0.97
R2511:Ptprm	UTSW	17	66693778	missense	probably damaging	1.00
R3726:Ptprm	UTSW	17	66956860	missense	possibly damaging	0.91
R3824:Ptprm	UTSW	17	66809575	missense	probably benign	0.40
R4057:Ptprm	UTSW	17	67075663	missense	possibly damaging	0.93
R4559:Ptprm	UTSW	17	66683408	missense	possibly damaging	0.74
R4598:Ptprm	UTSW	17	67095497	missense	probably benign	0.00
R4742:Ptprm	UTSW	17	66744751	nonsense	probably null
R4974:Ptprm	UTSW	17	66678067	missense	probably benign	0.01
R5157:Ptprm	UTSW	17	66957097	missense	probably benign	0.09
R5433:Ptprm	UTSW	17	66693473	missense	probably damaging	1.00
R5509:Ptprm	UTSW	17	66689358	missense	probably damaging	1.00
R5586:Ptprm	UTSW	17	66920196	missense	probably damaging	1.00
R5820:Ptprm	UTSW	17	66689465	missense	probably damaging	1.00
R5867:Ptprm	UTSW	17	67045981	splice site	probably null
R6044:Ptprm	UTSW	17	66693862	missense	probably damaging	1.00
R6229:Ptprm	UTSW	17	66688300	missense	probably damaging	1.00
R6615:Ptprm	UTSW	17	67353956	critical splice donor site	probably null
R6969:Ptprm	UTSW	17	66912418	missense	possibly damaging	0.63
R7135:Ptprm	UTSW	17	66944288	missense	possibly damaging	0.93
R7161:Ptprm	UTSW	17	66809627	missense	probably benign	0.21
R7410:Ptprm	UTSW	17	66693566	missense	probably damaging	0.99
R7476:Ptprm	UTSW	17	66725791	missense	probably benign	0.01
R7789:Ptprm	UTSW	17	67095539	missense	probably damaging	1.00
R8027:Ptprm	UTSW	17	66944205	missense	probably damaging	1.00
R8089:Ptprm	UTSW	17	66683488	missense	possibly damaging	0.63
R8442:Ptprm	UTSW	17	66944317	missense	possibly damaging	0.70
R8476:Ptprm	UTSW	17	66944322	missense	probably damaging	1.00
R8866:Ptprm	UTSW	17	66809635	missense	probably benign	0.00
R8907:Ptprm	UTSW	17	66744737	missense	probably damaging	0.99
R8930:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R8932:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R9009:Ptprm	UTSW	17	66689359	missense	probably damaging	1.00
R9084:Ptprm	UTSW	17	66956953	missense	possibly damaging	0.93
R9338:Ptprm	UTSW	17	66762148	missense	probably damaging	1.00
R9514:Ptprm	UTSW	17	66809471	missense	probably damaging	1.00
R9610:Ptprm	UTSW	17	66693488	missense	probably damaging	1.00
R9611:Ptprm	UTSW	17	66693488	missense	probably damaging	1.00
R9620:Ptprm	UTSW	17	66809489	missense	probably damaging	1.00
R9663:Ptprm	UTSW	17	67191296	missense	probably benign	0.34
R9694:Ptprm	UTSW	17	66809489	missense	probably damaging	1.00
R9736:Ptprm	UTSW	17	66690567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCAACAGGTAACAGTCATTC -3'
(R):5'- CGAAACACTGGCTACTCCTG -3'

Sequencing Primer
(F):5'- AACAGTCATTCAGGTTAGGCTG -3'
(R):5'- ACTCCTGTGGGTGAAGTTTTAGAAAG -3'

Posted On

2015-05-14