Incidental Mutation 'R4113:Rhox3f'
ID314534
Institutional Source Beutler Lab
Gene Symbol Rhox3f
Ensembl Gene ENSMUSG00000095510
Gene Namereproductive homeobox 3F
SynonymsOTTMUSG00000017155
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4113 (G1)
Quality Score206
Status Not validated
ChromosomeX
Chromosomal Location37580992-37585496 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 37582019 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 140 (E140*)
Ref Sequence ENSEMBL: ENSMUSP00000138833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115172] [ENSMUST00000183696] [ENSMUST00000184451] [ENSMUST00000185008]
Predicted Effect probably null
Transcript: ENSMUST00000115172
AA Change: E140*
SMART Domains Protein: ENSMUSP00000110826
Gene: ENSMUSG00000095510
AA Change: E140*

DomainStartEndE-ValueType
HOX 154 214 1.89e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183696
AA Change: E97*
SMART Domains Protein: ENSMUSP00000139277
Gene: ENSMUSG00000095510
AA Change: E97*

DomainStartEndE-ValueType
SCOP:d1ftt__ 111 141 2e-3 SMART
Blast:HOX 111 146 5e-13 BLAST
low complexity region 190 203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184451
AA Change: E140*
SMART Domains Protein: ENSMUSP00000138833
Gene: ENSMUSG00000095510
AA Change: E140*

DomainStartEndE-ValueType
HOX 154 214 1.89e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185008
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC024139 A G 15: 76,121,627 M458T probably benign Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Catsper3 A G 13: 55,786,370 K35E probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Dcaf13 T A 15: 39,130,220 I236N probably damaging Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnah12 T C 14: 26,693,567 L41P probably damaging Het
Dnah17 T C 11: 118,112,594 K514R possibly damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Eya4 G T 10: 23,155,951 S235Y probably damaging Het
Fam208a C T 14: 27,459,961 R483* probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gdf3 A G 6: 122,607,057 I117T probably damaging Het
Gm5611 T A 9: 17,030,693 noncoding transcript Het
Gtf3c4 G A 2: 28,827,555 T771I probably damaging Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Hyls1 T A 9: 35,561,418 Y234F probably damaging Het
Irak1bp1 T C 9: 82,846,675 S220P probably benign Het
Lama1 G A 17: 67,764,703 V862I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr1271 A T 2: 90,266,340 L30H probably damaging Het
Olfr304 G A 7: 86,386,525 T45M possibly damaging Het
Pcdh8 T C 14: 79,767,513 D927G probably damaging Het
Prelid3a T C 18: 67,472,897 Y25H probably damaging Het
Ptprm T C 17: 66,725,813 D1015G probably damaging Het
Riox2 C T 16: 59,491,894 L465F probably benign Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Stab1 C T 14: 31,168,479 R5Q probably damaging Het
Stmn3 T C 2: 181,307,296 K135E possibly damaging Het
Synj2 G A 17: 6,007,965 G243S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tshz2 C A 2: 169,885,530 P213Q probably benign Het
Tssk4 A G 14: 55,650,373 T9A probably benign Het
Ube4a T A 9: 44,948,949 I272F probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Vmn2r87 T C 10: 130,479,822 D125G probably benign Het
Yap1 A T 9: 7,938,431 *358K probably null Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Rhox3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02476:Rhox3f APN X 37581539 splice site probably benign
R2365:Rhox3f UTSW X 37582019 nonsense probably null
R4111:Rhox3f UTSW X 37582019 nonsense probably null
R4112:Rhox3f UTSW X 37582019 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGTACCAAGGTTTTGCCG -3'
(R):5'- TGCTCCCATCAAGTAGGAGAAAAG -3'

Sequencing Primer
(F):5'- CCAAGGTTTTGCCGGCTGAAG -3'
(R):5'- AGGCCAGGCAATCTCCTC -3'
Posted On2015-05-14