Mutagenetix > Incidental Mutation

Incidental Mutation 'R4114:Cdh23'

314555

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin 23 (otocadherin)

Synonyms

nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D

MMRRC Submission

040990-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.608) question?

Stock #

R4114 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60302748-60696490 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 60421040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000101104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000073242

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105461

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105462

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105463

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105464

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128249

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135638

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	T	C	7: 140,297,910 (GRCm38)	V935A	probably damaging	Het
6030468B19Rik	T	G	11: 117,802,967 (GRCm38)	S87A	probably damaging	Het
Abca16	T	C	7: 120,527,067 (GRCm38)	F1149L	probably benign	Het
Abcf1	A	T	17: 35,959,254 (GRCm38)	D637E	probably benign	Het
Ankrd34c	A	G	9: 89,729,874 (GRCm38)	L138P	probably damaging	Het
C87977	A	T	4: 144,209,603 (GRCm38)	L29H	probably damaging	Het
Cep44	T	C	8: 56,545,422 (GRCm38)	T74A	probably benign	Het
Colq	T	A	14: 31,557,867 (GRCm38)	M1L	probably benign	Het
Cym	A	T	3: 107,219,749 (GRCm38)	L30Q	probably damaging	Het
Dpp6	T	A	5: 27,469,487 (GRCm38)		probably null	Het
Gbe1	G	T	16: 70,483,827 (GRCm38)	G372V	possibly damaging	Het
Hdc	T	A	2: 126,601,818 (GRCm38)	M314L	probably benign	Het
Ino80b	A	G	6: 83,124,140 (GRCm38)	S149P	probably benign	Het
Itpr2	C	T	6: 146,425,510 (GRCm38)	V120I	probably damaging	Het
Morc3	G	A	16: 93,873,339 (GRCm38)	D801N	probably benign	Het
Mpped1	A	G	15: 83,796,709 (GRCm38)		probably benign	Het
Nek5	G	A	8: 22,111,162 (GRCm38)	T181M	probably damaging	Het
Nlrp4a	T	G	7: 26,449,940 (GRCm38)	F324C	probably damaging	Het
Nop56	T	C	2: 130,276,673 (GRCm38)		probably null	Het
Olfr1044	A	T	2: 86,171,415 (GRCm38)	V134D	possibly damaging	Het
Olfr804	T	C	10: 129,705,799 (GRCm38)	L307S	probably benign	Het
Pcdhb3	A	G	18: 37,302,040 (GRCm38)	N353S	probably benign	Het
Pde8a	T	A	7: 81,282,807 (GRCm38)		probably null	Het
Ryr2	C	T	13: 11,692,682 (GRCm38)	R2823H	probably damaging	Het
Sec22a	A	G	16: 35,318,832 (GRCm38)	F232S	probably damaging	Het
Slc7a1	T	C	5: 148,342,057 (GRCm38)	T302A	probably damaging	Het
Sult2a2	A	T	7: 13,734,783 (GRCm38)	Q58L	probably benign	Het
Tek	T	C	4: 94,849,683 (GRCm38)	S657P	probably damaging	Het
Trim5	A	G	7: 104,265,740 (GRCm38)	L374P	probably damaging	Het
Tspan18	C	A	2: 93,311,946 (GRCm38)		probably null	Het
Vmn2r37	T	A	7: 9,210,093 (GRCm38)		probably null	Het
Zbbx	T	C	3: 75,139,598 (GRCm38)	T121A	probably benign	Het
Zfp35	A	C	18: 24,002,709 (GRCm38)	I37L	probably benign	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60,523,548 (GRCm38)	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60,421,141 (GRCm38)	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60,307,522 (GRCm38)	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60,466,097 (GRCm38)	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60,312,624 (GRCm38)	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60,310,787 (GRCm38)	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60,385,069 (GRCm38)	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60,314,694 (GRCm38)	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60,409,147 (GRCm38)	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60,597,725 (GRCm38)	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60,331,833 (GRCm38)	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60,303,513 (GRCm38)	missense	probably benign
IGL01767:Cdh23	APN	10	60,315,724 (GRCm38)	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60,311,137 (GRCm38)	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60,419,819 (GRCm38)	splice site	probably null
IGL02025:Cdh23	APN	10	60,385,143 (GRCm38)	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60,523,560 (GRCm38)	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60,597,765 (GRCm38)	splice site	probably benign
IGL02175:Cdh23	APN	10	60,331,308 (GRCm38)	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60,305,124 (GRCm38)	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60,323,523 (GRCm38)	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60,465,543 (GRCm38)	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60,317,942 (GRCm38)	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60,385,179 (GRCm38)	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60,650,122 (GRCm38)	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60,465,995 (GRCm38)	splice site	probably benign
IGL02626:Cdh23	APN	10	60,391,801 (GRCm38)	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60,311,364 (GRCm38)	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60,376,814 (GRCm38)	missense	probably damaging	0.99
dee_dee	UTSW	10	60,308,056 (GRCm38)	nonsense	probably null
hersey	UTSW	10	60,308,036 (GRCm38)	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60,312,624 (GRCm38)	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60,314,620 (GRCm38)	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60,465,458 (GRCm38)	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60,413,173 (GRCm38)	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60,530,978 (GRCm38)	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60,530,978 (GRCm38)	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60,312,587 (GRCm38)	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60,308,056 (GRCm38)	nonsense	probably null
R0172:Cdh23	UTSW	10	60,319,632 (GRCm38)	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60,317,059 (GRCm38)	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60,379,315 (GRCm38)	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60,410,797 (GRCm38)	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60,386,946 (GRCm38)	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60,316,596 (GRCm38)	splice site	probably benign
R0545:Cdh23	UTSW	10	60,331,291 (GRCm38)	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60,433,777 (GRCm38)	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60,323,374 (GRCm38)	nonsense	probably null
R0647:Cdh23	UTSW	10	60,307,902 (GRCm38)	missense	probably damaging	0.99
R0730:Cdh23	UTSW	10	60,323,714 (GRCm38)	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60,406,421 (GRCm38)	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60,410,860 (GRCm38)	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60,534,510 (GRCm38)	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60,331,793 (GRCm38)	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60,312,392 (GRCm38)	splice site	probably benign
R1449:Cdh23	UTSW	10	60,376,951 (GRCm38)	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60,487,120 (GRCm38)	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60,379,343 (GRCm38)	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60,314,331 (GRCm38)	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60,419,699 (GRCm38)	splice site	probably benign
R1704:Cdh23	UTSW	10	60,314,611 (GRCm38)	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60,523,536 (GRCm38)	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60,326,076 (GRCm38)	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60,488,542 (GRCm38)	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60,391,726 (GRCm38)	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60,331,281 (GRCm38)	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60,323,297 (GRCm38)	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60,436,818 (GRCm38)	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60,323,570 (GRCm38)	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60,410,873 (GRCm38)	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60,385,222 (GRCm38)	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60,323,582 (GRCm38)	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60,378,751 (GRCm38)	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60,314,227 (GRCm38)	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60,466,043 (GRCm38)	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60,312,587 (GRCm38)	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60,596,730 (GRCm38)	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60,305,583 (GRCm38)	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60,305,583 (GRCm38)	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60,466,004 (GRCm38)	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60,317,128 (GRCm38)	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60,317,128 (GRCm38)	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60,323,445 (GRCm38)	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60,316,724 (GRCm38)	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60,382,653 (GRCm38)	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60,382,653 (GRCm38)	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60,382,653 (GRCm38)	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60,307,496 (GRCm38)	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60,409,010 (GRCm38)	splice site	probably benign
R3424:Cdh23	UTSW	10	60,376,881 (GRCm38)	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60,327,370 (GRCm38)	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60,327,370 (GRCm38)	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60,657,326 (GRCm38)	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60,657,326 (GRCm38)	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60,657,326 (GRCm38)	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60,410,822 (GRCm38)	missense	possibly damaging	0.51
R4273:Cdh23	UTSW	10	60,311,161 (GRCm38)	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60,303,493 (GRCm38)	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60,385,059 (GRCm38)	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60,311,086 (GRCm38)	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60,534,423 (GRCm38)	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60,409,044 (GRCm38)	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60,337,666 (GRCm38)	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60,331,350 (GRCm38)	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60,409,077 (GRCm38)	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60,385,038 (GRCm38)	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60,419,777 (GRCm38)	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60,391,784 (GRCm38)	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60,376,934 (GRCm38)	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60,337,851 (GRCm38)	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60,307,935 (GRCm38)	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60,308,032 (GRCm38)	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60,304,848 (GRCm38)	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60,436,807 (GRCm38)	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60,312,282 (GRCm38)	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60,312,572 (GRCm38)	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60,657,265 (GRCm38)	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60,337,762 (GRCm38)	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60,314,311 (GRCm38)	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60,534,386 (GRCm38)	splice site	probably null
R5673:Cdh23	UTSW	10	60,307,857 (GRCm38)	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60,393,023 (GRCm38)	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60,407,480 (GRCm38)	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60,331,317 (GRCm38)	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60,305,609 (GRCm38)	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60,406,392 (GRCm38)	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60,306,128 (GRCm38)	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60,384,934 (GRCm38)	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60,534,535 (GRCm38)	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60,428,379 (GRCm38)	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60,377,821 (GRCm38)	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60,392,984 (GRCm38)	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60,413,577 (GRCm38)	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60,307,982 (GRCm38)	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60,331,326 (GRCm38)	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60,465,542 (GRCm38)	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60,534,535 (GRCm38)	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60,433,758 (GRCm38)	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60,434,512 (GRCm38)	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60,410,821 (GRCm38)	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60,426,672 (GRCm38)	nonsense	probably null
R6302:Cdh23	UTSW	10	60,305,093 (GRCm38)	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60,413,151 (GRCm38)	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60,438,847 (GRCm38)	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60,308,036 (GRCm38)	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60,331,830 (GRCm38)	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60,306,168 (GRCm38)	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60,378,871 (GRCm38)	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60,306,122 (GRCm38)	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60,487,114 (GRCm38)	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60,438,856 (GRCm38)	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60,650,114 (GRCm38)	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60,337,306 (GRCm38)	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60,530,991 (GRCm38)	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60,331,788 (GRCm38)	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60,378,751 (GRCm38)	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60,387,044 (GRCm38)	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60,307,980 (GRCm38)	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60,312,599 (GRCm38)	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60,331,817 (GRCm38)	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60,376,841 (GRCm38)	missense	probably benign
R7335:Cdh23	UTSW	10	60,305,116 (GRCm38)	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60,530,996 (GRCm38)	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60,410,910 (GRCm38)	missense	probably damaging	1.00
R7366:Cdh23	UTSW	10	60,315,692 (GRCm38)	nonsense	probably null
R7374:Cdh23	UTSW	10	60,317,900 (GRCm38)	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60,306,224 (GRCm38)	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60,384,945 (GRCm38)	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60,323,550 (GRCm38)	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60,407,407 (GRCm38)	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60,305,152 (GRCm38)	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60,337,264 (GRCm38)	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60,312,577 (GRCm38)	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60,385,194 (GRCm38)	missense	probably benign	0.07
R7867:Cdh23	UTSW	10	60,314,611 (GRCm38)	missense	probably damaging	1.00
R7878:Cdh23	UTSW	10	60,314,200 (GRCm38)	missense	possibly damaging	0.69
R7915:Cdh23	UTSW	10	60,307,889 (GRCm38)	missense	probably damaging	0.97
R7922:Cdh23	UTSW	10	60,382,706 (GRCm38)	missense	probably benign	0.31
R7963:Cdh23	UTSW	10	60,336,188 (GRCm38)	missense	probably damaging	1.00
R7997:Cdh23	UTSW	10	60,596,739 (GRCm38)	missense	possibly damaging	0.81
R8167:Cdh23	UTSW	10	60,314,383 (GRCm38)	missense	probably benign	0.12
R8167:Cdh23	UTSW	10	60,337,693 (GRCm38)	missense	probably damaging	0.96
R8258:Cdh23	UTSW	10	60,315,656 (GRCm38)	missense	probably damaging	0.99
R8259:Cdh23	UTSW	10	60,315,656 (GRCm38)	missense	probably damaging	0.99
R8317:Cdh23	UTSW	10	60,436,789 (GRCm38)	missense	probably damaging	1.00
R8317:Cdh23	UTSW	10	60,311,258 (GRCm38)	critical splice donor site	probably null
R8326:Cdh23	UTSW	10	60,438,812 (GRCm38)	missense	possibly damaging	0.55
R8333:Cdh23	UTSW	10	60,314,611 (GRCm38)	missense	probably damaging	1.00
R8348:Cdh23	UTSW	10	60,331,728 (GRCm38)	missense	probably benign	0.43
R8366:Cdh23	UTSW	10	60,325,020 (GRCm38)	missense	probably benign
R8504:Cdh23	UTSW	10	60,438,839 (GRCm38)	missense	probably benign	0.00
R8676:Cdh23	UTSW	10	60,410,910 (GRCm38)	missense	probably damaging	1.00
R8781:Cdh23	UTSW	10	60,331,788 (GRCm38)	missense	probably damaging	1.00
R8785:Cdh23	UTSW	10	60,311,335 (GRCm38)	missense	probably damaging	1.00
R8788:Cdh23	UTSW	10	60,488,593 (GRCm38)	missense	probably damaging	1.00
R8802:Cdh23	UTSW	10	60,409,098 (GRCm38)	missense	probably benign	0.04
R8837:Cdh23	UTSW	10	60,324,976 (GRCm38)	missense	probably benign	0.28
R8863:Cdh23	UTSW	10	60,376,834 (GRCm38)	nonsense	probably null
R8889:Cdh23	UTSW	10	60,307,505 (GRCm38)	missense	probably damaging	0.97
R8892:Cdh23	UTSW	10	60,307,505 (GRCm38)	missense	probably damaging	0.97
R8921:Cdh23	UTSW	10	60,305,129 (GRCm38)	missense	probably damaging	0.99
R8980:Cdh23	UTSW	10	60,337,846 (GRCm38)	missense	probably benign	0.06
R9000:Cdh23	UTSW	10	60,304,498 (GRCm38)	missense	possibly damaging	0.82
R9043:Cdh23	UTSW	10	60,315,699 (GRCm38)	missense	probably benign	0.00
R9046:Cdh23	UTSW	10	60,382,524 (GRCm38)	intron	probably benign
R9070:Cdh23	UTSW	10	60,337,760 (GRCm38)	missense	probably benign
R9075:Cdh23	UTSW	10	60,317,762 (GRCm38)	missense	probably damaging	1.00
R9132:Cdh23	UTSW	10	60,434,504 (GRCm38)	splice site	probably benign
R9155:Cdh23	UTSW	10	60,413,706 (GRCm38)	missense	probably damaging	0.99
R9171:Cdh23	UTSW	10	60,326,031 (GRCm38)	missense	probably benign	0.00
R9179:Cdh23	UTSW	10	60,317,885 (GRCm38)	missense	probably benign	0.06
R9186:Cdh23	UTSW	10	60,307,527 (GRCm38)	missense	possibly damaging	0.54
R9189:Cdh23	UTSW	10	60,307,527 (GRCm38)	missense	possibly damaging	0.54
R9207:Cdh23	UTSW	10	60,407,431 (GRCm38)	missense	probably damaging	1.00
R9240:Cdh23	UTSW	10	60,379,265 (GRCm38)	missense	probably benign	0.00
R9244:Cdh23	UTSW	10	60,413,663 (GRCm38)	missense	possibly damaging	0.93
R9284:Cdh23	UTSW	10	60,307,527 (GRCm38)	missense	possibly damaging	0.54
R9286:Cdh23	UTSW	10	60,307,527 (GRCm38)	missense	possibly damaging	0.54
R9287:Cdh23	UTSW	10	60,307,527 (GRCm38)	missense	possibly damaging	0.54
R9302:Cdh23	UTSW	10	60,307,527 (GRCm38)	missense	possibly damaging	0.54
R9352:Cdh23	UTSW	10	60,307,527 (GRCm38)	missense	possibly damaging	0.54
R9353:Cdh23	UTSW	10	60,307,527 (GRCm38)	missense	possibly damaging	0.54
R9423:Cdh23	UTSW	10	60,312,608 (GRCm38)	missense	probably damaging	1.00
R9513:Cdh23	UTSW	10	60,331,216 (GRCm38)	missense	probably damaging	0.99
R9577:Cdh23	UTSW	10	60,311,116 (GRCm38)	missense	probably damaging	1.00
R9598:Cdh23	UTSW	10	60,378,795 (GRCm38)	missense	probably benign	0.01
R9631:Cdh23	UTSW	10	60,407,389 (GRCm38)	missense	possibly damaging	0.49
R9652:Cdh23	UTSW	10	60,331,356 (GRCm38)	missense	probably damaging	1.00
R9725:Cdh23	UTSW	10	60,596,782 (GRCm38)	missense	probably benign	0.02
X0052:Cdh23	UTSW	10	60,385,134 (GRCm38)	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60,413,644 (GRCm38)	missense	probably benign	0.35
Z1176:Cdh23	UTSW	10	60,428,321 (GRCm38)	missense	probably benign
Z1176:Cdh23	UTSW	10	60,310,770 (GRCm38)	missense	probably damaging	1.00
Z1177:Cdh23	UTSW	10	60,434,614 (GRCm38)	critical splice acceptor site	probably null
Z1177:Cdh23	UTSW	10	60,323,555 (GRCm38)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AAGAGGGACCTGGTCATCAG -3'
(R):5'- TGTGGCTTGCAAGTATATCTCTAC -3'

Sequencing Primer
(F):5'- GGAGGGACCTGGTCATCAG -3'
(R):5'- ACGTCTATTTCCTTCTCCCTGCATG -3'

Posted On

2015-05-14