Incidental Mutation 'R4114:Or6c6c'
ID 314556
Institutional Source Beutler Lab
Gene Symbol Or6c6c
Ensembl Gene ENSMUSG00000095401
Gene Name olfactory receptor family 6 subfamily C member 6C
Synonyms GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
MMRRC Submission 040990-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4114 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 129540749-129541693 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129541668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 307 (L307S)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
AlphaFold Q7TRH7
Predicted Effect probably benign
Transcript: ENSMUST00000077312
AA Change: L307S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: L307S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213331
AA Change: L307S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216747
Meta Mutation Damage Score 0.2062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik T G 11: 117,693,793 (GRCm39) S87A probably damaging Het
Abca16 T C 7: 120,126,290 (GRCm39) F1149L probably benign Het
Abcf1 A T 17: 36,270,146 (GRCm39) D637E probably benign Het
Ankrd34c A G 9: 89,611,927 (GRCm39) L138P probably damaging Het
Cdh23 A G 10: 60,256,819 (GRCm39) probably null Het
Cep44 T C 8: 56,998,457 (GRCm39) T74A probably benign Het
Colq T A 14: 31,279,824 (GRCm39) M1L probably benign Het
Cym A T 3: 107,127,065 (GRCm39) L30Q probably damaging Het
Dpp6 T A 5: 27,674,485 (GRCm39) probably null Het
Gbe1 G T 16: 70,280,715 (GRCm39) G372V possibly damaging Het
Hdc T A 2: 126,443,738 (GRCm39) M314L probably benign Het
Ino80b A G 6: 83,101,121 (GRCm39) S149P probably benign Het
Itpr2 C T 6: 146,327,008 (GRCm39) V120I probably damaging Het
Morc3 G A 16: 93,670,227 (GRCm39) D801N probably benign Het
Mpped1 A G 15: 83,680,910 (GRCm39) probably benign Het
Nek5 G A 8: 22,601,178 (GRCm39) T181M probably damaging Het
Nlrp4a T G 7: 26,149,365 (GRCm39) F324C probably damaging Het
Nop56 T C 2: 130,118,593 (GRCm39) probably null Het
Or8u9 A T 2: 86,001,759 (GRCm39) V134D possibly damaging Het
Pcdhb3 A G 18: 37,435,093 (GRCm39) N353S probably benign Het
Pde8a T A 7: 80,932,555 (GRCm39) probably null Het
Pramel29 A T 4: 143,936,173 (GRCm39) L29H probably damaging Het
Ryr2 C T 13: 11,707,568 (GRCm39) R2823H probably damaging Het
Scart2 T C 7: 139,877,823 (GRCm39) V935A probably damaging Het
Sec22a A G 16: 35,139,202 (GRCm39) F232S probably damaging Het
Slc7a1 T C 5: 148,278,867 (GRCm39) T302A probably damaging Het
Sult2a2 A T 7: 13,468,708 (GRCm39) Q58L probably benign Het
Tek T C 4: 94,737,920 (GRCm39) S657P probably damaging Het
Trim5 A G 7: 103,914,947 (GRCm39) L374P probably damaging Het
Tspan18 C A 2: 93,142,291 (GRCm39) probably null Het
Vmn2r37 T A 7: 9,213,092 (GRCm39) probably null Het
Zbbx T C 3: 75,046,905 (GRCm39) T121A probably benign Het
Zfp35 A C 18: 24,135,766 (GRCm39) I37L probably benign Het
Other mutations in Or6c6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Or6c6c APN 10 129,541,492 (GRCm39) missense probably benign 0.01
IGL02041:Or6c6c APN 10 129,541,104 (GRCm39) missense probably damaging 1.00
IGL02245:Or6c6c APN 10 129,541,608 (GRCm39) missense probably damaging 1.00
IGL02341:Or6c6c APN 10 129,541,358 (GRCm39) missense probably damaging 0.99
IGL02433:Or6c6c APN 10 129,541,445 (GRCm39) missense probably benign 0.01
authen UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R0111:Or6c6c UTSW 10 129,541,146 (GRCm39) missense probably damaging 1.00
R0309:Or6c6c UTSW 10 129,541,008 (GRCm39) missense probably benign 0.38
R0326:Or6c6c UTSW 10 129,541,638 (GRCm39) missense possibly damaging 0.69
R0374:Or6c6c UTSW 10 129,541,516 (GRCm39) missense probably benign 0.00
R1573:Or6c6c UTSW 10 129,541,487 (GRCm39) missense probably damaging 1.00
R1663:Or6c6c UTSW 10 129,541,160 (GRCm39) missense probably benign 0.44
R1778:Or6c6c UTSW 10 129,541,574 (GRCm39) missense probably benign 0.01
R1789:Or6c6c UTSW 10 129,541,476 (GRCm39) missense possibly damaging 0.82
R1906:Or6c6c UTSW 10 129,541,365 (GRCm39) missense probably benign 0.00
R2108:Or6c6c UTSW 10 129,541,490 (GRCm39) missense probably benign
R2211:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R2432:Or6c6c UTSW 10 129,540,794 (GRCm39) missense possibly damaging 0.91
R2902:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R5149:Or6c6c UTSW 10 129,541,377 (GRCm39) missense probably benign 0.00
R5153:Or6c6c UTSW 10 129,541,026 (GRCm39) missense probably benign 0.05
R5846:Or6c6c UTSW 10 129,540,756 (GRCm39) missense probably damaging 0.99
R6553:Or6c6c UTSW 10 129,540,932 (GRCm39) missense probably benign 0.07
R7676:Or6c6c UTSW 10 129,541,155 (GRCm39) missense possibly damaging 0.63
R8161:Or6c6c UTSW 10 129,540,753 (GRCm39) missense possibly damaging 0.94
R9266:Or6c6c UTSW 10 129,541,547 (GRCm39) missense probably benign 0.17
R9318:Or6c6c UTSW 10 129,541,283 (GRCm39) missense probably benign 0.00
R9334:Or6c6c UTSW 10 129,541,683 (GRCm39) missense probably benign 0.00
R9746:Or6c6c UTSW 10 129,541,208 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCACTTCCCACATGATTGTTG -3'
(R):5'- TGAAGAGTGCAAGCTTTCATGG -3'

Sequencing Primer
(F):5'- CCACATGATTGTTGTCTCCATAAC -3'
(R):5'- TTCATGGGAAAGTAGAGTATAAGGTG -3'
Posted On 2015-05-14