Mutagenetix > Incidental Mutations

Incidental Mutation 'R4115:Spta1'

314571

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

041630-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.576) question?

Stock #

R4115 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

174172776-174248450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 174240357 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 2117 (W2117R)

Ref Sequence

ENSEMBL: ENSMUSP00000027817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027817
AA Change: W2117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: W2117R

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156092

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd34c	A	G	9: 89,729,874	L138P	probably damaging	Het
Aplp2	C	T	9: 31,157,826	R569Q	probably benign	Het
BC005561	T	C	5: 104,519,433	L607S	probably damaging	Het
BC035044	C	T	6: 128,890,850		probably benign	Het
Camta2	T	C	11: 70,676,474	M626V	possibly damaging	Het
Cdh7	G	A	1: 110,138,309	R771Q	probably benign	Het
Chd3	T	G	11: 69,357,517	I850L	possibly damaging	Het
Cspg4	T	A	9: 56,898,394	L2163Q	probably damaging	Het
Cyp2c66	A	G	19: 39,176,559	D328G	possibly damaging	Het
Dcun1d3	T	C	7: 119,859,734	N26S	probably benign	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Gm13083	A	G	4: 143,617,456	D442G	probably benign	Het
Gnl3	T	G	14: 31,016,856	K79Q	probably damaging	Het
Hat1	A	G	2: 71,441,222	T380A	probably benign	Het
Hectd1	A	T	12: 51,768,723	L1527*	probably null	Het
Ighv11-1	A	G	12: 113,982,065	V56A	probably benign	Het
Ism2	A	G	12: 87,287,031	I80T	probably benign	Het
Itpr2	C	T	6: 146,425,510	V120I	probably damaging	Het
Kif1a	T	A	1: 93,052,538	E823V	probably damaging	Het
Letm2	T	A	8: 25,580,327	K432*	probably null	Het
Mc4r	T	A	18: 66,859,979	Y21F	probably benign	Het
Morc3	G	A	16: 93,873,339	D801N	probably benign	Het
Mycbpap	C	A	11: 94,512,225		probably null	Het
Nfkbil1	A	G	17: 35,221,310	M129T	probably damaging	Het
Notch3	C	A	17: 32,158,433	C223F	probably damaging	Het
Nrcam	T	C	12: 44,566,326	V606A	possibly damaging	Het
Nudcd2	T	C	11: 40,736,607	M118T	probably damaging	Het
Olfr341	A	T	2: 36,479,785	L115Q	probably damaging	Het
Oraov1	G	A	7: 144,919,646	V142M	possibly damaging	Het
Pcsk5	C	T	19: 17,433,419	D1870N	unknown	Het
Pde3b	T	C	7: 114,521,727	F696L	probably damaging	Het
Pde8a	T	A	7: 81,282,807		probably null	Het
Pgm2	C	T	4: 99,962,151	Q191*	probably null	Het
Psg20	A	G	7: 18,685,980	S5P	probably damaging	Het
Reps1	C	T	10: 18,104,207	P397S	possibly damaging	Het
Sec22a	A	G	16: 35,318,832	F232S	probably damaging	Het
Spata13	G	T	14: 60,692,478	G168V	probably damaging	Het
Sptbn4	C	T	7: 27,391,570	E1399K	probably damaging	Het
Tek	T	C	4: 94,849,683	S657P	probably damaging	Het
Trpm6	T	C	19: 18,832,557	W1106R	probably damaging	Het
Tssk3	T	C	4: 129,489,507	Y124C	probably damaging	Het
Ugt2b1	A	G	5: 86,926,414	W29R	probably damaging	Het
Vmn2r97	T	C	17: 18,928,070	F76L	probably benign	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174208390	nonsense	probably null
IGL01095:Spta1	APN	1	174213485	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174187263	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174203311	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174217159	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174208394	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174244180	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174174372	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174213862	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174203294	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174190231	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174217689	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174174463	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174218814	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174244110	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174211598	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174187288	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174181058	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174218743	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174213918	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174214144	missense	probably benign	0.08
H8786:Spta1	UTSW	1	174179839	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174205273	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174205273	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174217943	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174217943	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174207032	splice site	probably benign
R0172:Spta1	UTSW	1	174230786	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174192960	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174192960	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174217894	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174243179	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174218451	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174213942	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174224457	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174181104	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174184690	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174174426	missense	possibly damaging	0.85
R0941:Spta1	UTSW	1	174245205	unclassified	probably benign
R1131:Spta1	UTSW	1	174185647	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174211614	nonsense	probably null
R1184:Spta1	UTSW	1	174184690	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174222684	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174231325	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174247353	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174240166	missense	possibly damaging	0.94
R1555:Spta1	UTSW	1	174178749	missense	probably damaging	0.99
R1566:Spta1	UTSW	1	174184706	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174213495	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174179839	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174241042	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174245730	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174246549	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174195947	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174219839	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174240367	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174211647	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174244198	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174208344	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174212614	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174229258	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174192966	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174244114	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174174341	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174178656	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174208314	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174241137	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4082:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174174556	missense	probably benign	0.01
R4303:Spta1	UTSW	1	174179852	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174247424	nonsense	probably null
R4525:Spta1	UTSW	1	174207110	missense	probably null	1.00
R4614:Spta1	UTSW	1	174192977	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174191062	splice site	probably null
R4782:Spta1	UTSW	1	174230666	missense	probably benign	0.01
R4825:Spta1	UTSW	1	174244042	critical splice acceptor site	probably null
R4829:Spta1	UTSW	1	174237927	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174175830	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174175830	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174237834	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174217863	splice site	probably null
R4911:Spta1	UTSW	1	174185647	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174191056	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174246608	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174240223	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174247434	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174195985	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174215529	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174217193	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174175770	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174219902	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174214255	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174184797	intron	probably null
R5845:Spta1	UTSW	1	174241096	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174223328	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174224520	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174181776	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174218512	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174241087	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174214177	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174211646	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174214168	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174203322	missense	probably benign
R6387:Spta1	UTSW	1	174231333	missense	probably benign	0.01
R6451:Spta1	UTSW	1	174217201	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174187148	intron	probably null
R6533:Spta1	UTSW	1	174244147	missense	probably damaging	1.00
R6585:Spta1	UTSW	1	174178685	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174244042	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174209325	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174209352	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174199484	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174174510	missense	probably benign
R7151:Spta1	UTSW	1	174197751	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174184612	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174223271	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174222637	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174223349	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174197635	nonsense	probably null
R7472:Spta1	UTSW	1	174246499	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174197783	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174205378	missense	probably damaging	1.00
T0722:Spta1	UTSW	1	174191066	splice site	probably benign
X0028:Spta1	UTSW	1	174224450	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCAACAACTGGTGTGAGAACG -3'
(R):5'- GTTTCTTGACATCTGCCACAGC -3'

Sequencing Primer
(F):5'- CGCGGAAGAGGACTTGTC -3'
(R):5'- GATCCACTGGTCATGCTT -3'

Posted On

2015-05-14