Incidental Mutation 'R4115:Pde8a'
ID314586
Institutional Source Beutler Lab
Gene Symbol Pde8a
Ensembl Gene ENSMUSG00000025584
Gene Namephosphodiesterase 8A
SynonymsPde8
MMRRC Submission 041630-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4115 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81213596-81334533 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 81282807 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026672]
Predicted Effect probably null
Transcript: ENSMUST00000026672
SMART Domains Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Blast:REC 79 194 2e-48 BLAST
PAS 211 277 2.18e-2 SMART
Blast:HDc 403 451 4e-11 BLAST
HDc 548 734 5.78e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
BC005561 T C 5: 104,519,433 L607S probably damaging Het
BC035044 C T 6: 128,890,850 probably benign Het
Camta2 T C 11: 70,676,474 M626V possibly damaging Het
Cdh7 G A 1: 110,138,309 R771Q probably benign Het
Chd3 T G 11: 69,357,517 I850L possibly damaging Het
Cspg4 T A 9: 56,898,394 L2163Q probably damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Dcun1d3 T C 7: 119,859,734 N26S probably benign Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gnl3 T G 14: 31,016,856 K79Q probably damaging Het
Hat1 A G 2: 71,441,222 T380A probably benign Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Ighv11-1 A G 12: 113,982,065 V56A probably benign Het
Ism2 A G 12: 87,287,031 I80T probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kif1a T A 1: 93,052,538 E823V probably damaging Het
Letm2 T A 8: 25,580,327 K432* probably null Het
Mc4r T A 18: 66,859,979 Y21F probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mycbpap C A 11: 94,512,225 probably null Het
Nfkbil1 A G 17: 35,221,310 M129T probably damaging Het
Notch3 C A 17: 32,158,433 C223F probably damaging Het
Nrcam T C 12: 44,566,326 V606A possibly damaging Het
Nudcd2 T C 11: 40,736,607 M118T probably damaging Het
Olfr341 A T 2: 36,479,785 L115Q probably damaging Het
Oraov1 G A 7: 144,919,646 V142M possibly damaging Het
Pcsk5 C T 19: 17,433,419 D1870N unknown Het
Pde3b T C 7: 114,521,727 F696L probably damaging Het
Pgm2 C T 4: 99,962,151 Q191* probably null Het
Psg20 A G 7: 18,685,980 S5P probably damaging Het
Reps1 C T 10: 18,104,207 P397S possibly damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Spata13 G T 14: 60,692,478 G168V probably damaging Het
Spta1 T C 1: 174,240,357 W2117R probably damaging Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trpm6 T C 19: 18,832,557 W1106R probably damaging Het
Tssk3 T C 4: 129,489,507 Y124C probably damaging Het
Ugt2b1 A G 5: 86,926,414 W29R probably damaging Het
Vmn2r97 T C 17: 18,928,070 F76L probably benign Het
Other mutations in Pde8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Pde8a APN 7 81306708 missense possibly damaging 0.62
IGL00808:Pde8a APN 7 81283014 critical splice donor site probably null
IGL01134:Pde8a APN 7 81319078 missense possibly damaging 0.86
IGL01443:Pde8a APN 7 81324181 missense probably damaging 1.00
IGL02044:Pde8a APN 7 81317449 critical splice donor site probably null
IGL02269:Pde8a APN 7 81308802 splice site probably benign
IGL02528:Pde8a APN 7 81293189 splice site probably benign
IGL02738:Pde8a APN 7 81326342 missense probably damaging 1.00
IGL02937:Pde8a APN 7 81295771 splice site probably benign
IGL03072:Pde8a APN 7 81308809 missense probably damaging 1.00
cast_iron UTSW 7 81282807 intron probably null
K7894:Pde8a UTSW 7 81306765 missense probably damaging 1.00
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0547:Pde8a UTSW 7 81324130 missense probably benign 0.00
R0552:Pde8a UTSW 7 81317347 missense probably benign 0.12
R1342:Pde8a UTSW 7 81302294 critical splice donor site probably null
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1502:Pde8a UTSW 7 81292259 missense probably damaging 1.00
R1568:Pde8a UTSW 7 81292263 missense probably damaging 1.00
R1768:Pde8a UTSW 7 81300723 splice site probably null
R2076:Pde8a UTSW 7 81308945 missense probably benign 0.11
R2165:Pde8a UTSW 7 81295768 critical splice donor site probably null
R2385:Pde8a UTSW 7 81282992 missense probably benign 0.45
R2518:Pde8a UTSW 7 81317422 missense probably benign 0.00
R4001:Pde8a UTSW 7 81317356 missense probably damaging 1.00
R4114:Pde8a UTSW 7 81282807 intron probably null
R4159:Pde8a UTSW 7 81320659 missense probably benign 0.13
R4299:Pde8a UTSW 7 81328035 missense probably benign
R4544:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4545:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4561:Pde8a UTSW 7 81308820 nonsense probably null
R4562:Pde8a UTSW 7 81308820 nonsense probably null
R4563:Pde8a UTSW 7 81308820 nonsense probably null
R4615:Pde8a UTSW 7 81320737 missense probably damaging 1.00
R4808:Pde8a UTSW 7 81282931 missense probably benign
R5396:Pde8a UTSW 7 81333422 missense probably damaging 1.00
R5840:Pde8a UTSW 7 81213965 missense probably benign
R5892:Pde8a UTSW 7 81295691 missense probably damaging 0.99
R6621:Pde8a UTSW 7 81293130 critical splice acceptor site probably null
R7067:Pde8a UTSW 7 81317326 missense probably benign 0.41
R7163:Pde8a UTSW 7 81306708 missense possibly damaging 0.62
R7483:Pde8a UTSW 7 81282833 missense probably benign 0.02
R7606:Pde8a UTSW 7 81332967 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATTTTAGCATTGACTGGCCG -3'
(R):5'- CATGGAACTCAGTCACGGAC -3'

Sequencing Primer
(F):5'- ACTGGCCGATGAATGCTAATGTC -3'
(R):5'- GCATCCATCTGTCGGGGATATC -3'
Posted On2015-05-14