Incidental Mutation 'R4115:Dcun1d3'
ID314588
Institutional Source Beutler Lab
Gene Symbol Dcun1d3
Ensembl Gene ENSMUSG00000048787
Gene NameDCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
Synonyms
MMRRC Submission 041630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4115 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119852796-119896298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119859734 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 26 (N26S)
Ref Sequence ENSEMBL: ENSMUSP00000147253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059851] [ENSMUST00000098080] [ENSMUST00000106519] [ENSMUST00000137888] [ENSMUST00000142120] [ENSMUST00000207233]
Predicted Effect probably benign
Transcript: ENSMUST00000059851
AA Change: N26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058968
Gene: ENSMUSG00000048787
AA Change: N26S

DomainStartEndE-ValueType
Pfam:Cullin_binding 161 277 6.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098080
AA Change: N26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095686
Gene: ENSMUSG00000048787
AA Change: N26S

DomainStartEndE-ValueType
Pfam:Cullin_binding 159 278 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106519
AA Change: N26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102129
Gene: ENSMUSG00000048787
AA Change: N26S

DomainStartEndE-ValueType
Pfam:Cullin_binding 159 278 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137888
AA Change: N26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000142120
AA Change: N26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118439
Gene: ENSMUSG00000048787
AA Change: N26S

DomainStartEndE-ValueType
PDB:4GBA|B 86 165 8e-53 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000207233
AA Change: N26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
BC005561 T C 5: 104,519,433 L607S probably damaging Het
BC035044 C T 6: 128,890,850 probably benign Het
Camta2 T C 11: 70,676,474 M626V possibly damaging Het
Cdh7 G A 1: 110,138,309 R771Q probably benign Het
Chd3 T G 11: 69,357,517 I850L possibly damaging Het
Cspg4 T A 9: 56,898,394 L2163Q probably damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gnl3 T G 14: 31,016,856 K79Q probably damaging Het
Hat1 A G 2: 71,441,222 T380A probably benign Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Ighv11-1 A G 12: 113,982,065 V56A probably benign Het
Ism2 A G 12: 87,287,031 I80T probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kif1a T A 1: 93,052,538 E823V probably damaging Het
Letm2 T A 8: 25,580,327 K432* probably null Het
Mc4r T A 18: 66,859,979 Y21F probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mycbpap C A 11: 94,512,225 probably null Het
Nfkbil1 A G 17: 35,221,310 M129T probably damaging Het
Notch3 C A 17: 32,158,433 C223F probably damaging Het
Nrcam T C 12: 44,566,326 V606A possibly damaging Het
Nudcd2 T C 11: 40,736,607 M118T probably damaging Het
Olfr341 A T 2: 36,479,785 L115Q probably damaging Het
Oraov1 G A 7: 144,919,646 V142M possibly damaging Het
Pcsk5 C T 19: 17,433,419 D1870N unknown Het
Pde3b T C 7: 114,521,727 F696L probably damaging Het
Pde8a T A 7: 81,282,807 probably null Het
Pgm2 C T 4: 99,962,151 Q191* probably null Het
Psg20 A G 7: 18,685,980 S5P probably damaging Het
Reps1 C T 10: 18,104,207 P397S possibly damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Spata13 G T 14: 60,692,478 G168V probably damaging Het
Spta1 T C 1: 174,240,357 W2117R probably damaging Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trpm6 T C 19: 18,832,557 W1106R probably damaging Het
Tssk3 T C 4: 129,489,507 Y124C probably damaging Het
Ugt2b1 A G 5: 86,926,414 W29R probably damaging Het
Vmn2r97 T C 17: 18,928,070 F76L probably benign Het
Other mutations in Dcun1d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0432:Dcun1d3 UTSW 7 119857950 nonsense probably null
R1219:Dcun1d3 UTSW 7 119859408 missense probably damaging 0.99
R1344:Dcun1d3 UTSW 7 119857935 missense probably damaging 1.00
R1418:Dcun1d3 UTSW 7 119857935 missense probably damaging 1.00
R4654:Dcun1d3 UTSW 7 119859519 missense probably damaging 1.00
R4784:Dcun1d3 UTSW 7 119857664 missense probably damaging 1.00
R5112:Dcun1d3 UTSW 7 119858027 missense probably damaging 0.98
R5732:Dcun1d3 UTSW 7 119858033 missense probably benign 0.06
R5935:Dcun1d3 UTSW 7 119859576 missense probably benign
R6037:Dcun1d3 UTSW 7 119857742 missense probably damaging 1.00
R6037:Dcun1d3 UTSW 7 119857742 missense probably damaging 1.00
R6224:Dcun1d3 UTSW 7 119859491 nonsense probably null
R7289:Dcun1d3 UTSW 7 119859641 missense possibly damaging 0.56
R7311:Dcun1d3 UTSW 7 119859511 missense probably damaging 0.96
R7658:Dcun1d3 UTSW 7 119857668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTTGTAGCGCCTGAATAG -3'
(R):5'- CCTGGCTCCTCTAACTGATG -3'

Sequencing Primer
(F):5'- AGAAGACTCCTCAGCATTGGTCTTG -3'
(R):5'- CTCCTCTAACTGATGGCATGTTGAAG -3'
Posted On2015-05-14