Incidental Mutation 'R4115:Ankrd34c'
ID314595
Institutional Source Beutler Lab
Gene Symbol Ankrd34c
Ensembl Gene ENSMUSG00000047606
Gene Nameankyrin repeat domain 34C
SynonymsLOC330998, B230218L05Rik
MMRRC Submission 041630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4115 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location89725245-89738475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89729874 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 138 (L138P)
Ref Sequence ENSEMBL: ENSMUSP00000140919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060700] [ENSMUST00000185470]
Predicted Effect probably damaging
Transcript: ENSMUST00000060700
AA Change: L138P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056787
Gene: ENSMUSG00000047606
AA Change: L138P

DomainStartEndE-ValueType
ANK 10 39 1.16e3 SMART
ANK 43 80 1.46e-2 SMART
ANK 84 114 1.52e0 SMART
ANK 118 147 1.33e2 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185470
AA Change: L138P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140919
Gene: ENSMUSG00000047606
AA Change: L138P

DomainStartEndE-ValueType
ANK 10 39 1.16e3 SMART
ANK 43 80 1.46e-2 SMART
ANK 84 114 1.52e0 SMART
ANK 118 147 1.33e2 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
Meta Mutation Damage Score 0.5936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
BC005561 T C 5: 104,519,433 L607S probably damaging Het
BC035044 C T 6: 128,890,850 probably benign Het
Camta2 T C 11: 70,676,474 M626V possibly damaging Het
Cdh7 G A 1: 110,138,309 R771Q probably benign Het
Chd3 T G 11: 69,357,517 I850L possibly damaging Het
Cspg4 T A 9: 56,898,394 L2163Q probably damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Dcun1d3 T C 7: 119,859,734 N26S probably benign Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gnl3 T G 14: 31,016,856 K79Q probably damaging Het
Hat1 A G 2: 71,441,222 T380A probably benign Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Ighv11-1 A G 12: 113,982,065 V56A probably benign Het
Ism2 A G 12: 87,287,031 I80T probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kif1a T A 1: 93,052,538 E823V probably damaging Het
Letm2 T A 8: 25,580,327 K432* probably null Het
Mc4r T A 18: 66,859,979 Y21F probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mycbpap C A 11: 94,512,225 probably null Het
Nfkbil1 A G 17: 35,221,310 M129T probably damaging Het
Notch3 C A 17: 32,158,433 C223F probably damaging Het
Nrcam T C 12: 44,566,326 V606A possibly damaging Het
Nudcd2 T C 11: 40,736,607 M118T probably damaging Het
Olfr341 A T 2: 36,479,785 L115Q probably damaging Het
Oraov1 G A 7: 144,919,646 V142M possibly damaging Het
Pcsk5 C T 19: 17,433,419 D1870N unknown Het
Pde3b T C 7: 114,521,727 F696L probably damaging Het
Pde8a T A 7: 81,282,807 probably null Het
Pgm2 C T 4: 99,962,151 Q191* probably null Het
Psg20 A G 7: 18,685,980 S5P probably damaging Het
Reps1 C T 10: 18,104,207 P397S possibly damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Spata13 G T 14: 60,692,478 G168V probably damaging Het
Spta1 T C 1: 174,240,357 W2117R probably damaging Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trpm6 T C 19: 18,832,557 W1106R probably damaging Het
Tssk3 T C 4: 129,489,507 Y124C probably damaging Het
Ugt2b1 A G 5: 86,926,414 W29R probably damaging Het
Vmn2r97 T C 17: 18,928,070 F76L probably benign Het
Other mutations in Ankrd34c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Ankrd34c APN 9 89729026 missense probably benign 0.15
IGL01630:Ankrd34c APN 9 89729826 missense probably damaging 0.99
IGL01683:Ankrd34c APN 9 89729797 missense probably benign 0.09
IGL01886:Ankrd34c APN 9 89730265 missense possibly damaging 0.71
IGL02323:Ankrd34c APN 9 89729980 missense possibly damaging 0.80
IGL02679:Ankrd34c APN 9 89730079 missense probably damaging 1.00
IGL03000:Ankrd34c APN 9 89729186 missense probably benign 0.00
IGL03008:Ankrd34c APN 9 89730284 start codon destroyed probably null 0.05
R0024:Ankrd34c UTSW 9 89729527 missense possibly damaging 0.93
R0107:Ankrd34c UTSW 9 89729484 missense probably benign
R1602:Ankrd34c UTSW 9 89729005 missense possibly damaging 0.66
R1879:Ankrd34c UTSW 9 89730073 missense probably damaging 1.00
R4114:Ankrd34c UTSW 9 89729874 missense probably damaging 1.00
R4116:Ankrd34c UTSW 9 89729874 missense probably damaging 1.00
R4291:Ankrd34c UTSW 9 89729764 nonsense probably null
R5012:Ankrd34c UTSW 9 89729656 missense probably benign 0.00
R5020:Ankrd34c UTSW 9 89729706 missense probably benign 0.16
R5747:Ankrd34c UTSW 9 89729761 missense possibly damaging 0.60
R6766:Ankrd34c UTSW 9 89729328 missense probably benign
R7011:Ankrd34c UTSW 9 89728948 nonsense probably null
R7614:Ankrd34c UTSW 9 89728861 missense probably damaging 0.96
R7651:Ankrd34c UTSW 9 89729410 missense possibly damaging 0.84
X0022:Ankrd34c UTSW 9 89729826 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTTCACTGGGTGGAGAAGC -3'
(R):5'- TGTTGGACAACAGGGCAGAC -3'

Sequencing Primer
(F):5'- CAGGCCAGAAGTCTTCAGTTC -3'
(R):5'- CCCAATATCCAGGATAAGTCTGG -3'
Posted On2015-05-14