Incidental Mutation 'R4116:Hoxd13'
ID314619
Institutional Source Beutler Lab
Gene Symbol Hoxd13
Ensembl Gene ENSMUSG00000001819
Gene Namehomeobox D13
SynonymsHox-4.8, spdh
MMRRC Submission 040859-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R4116 (G1)
Quality Score191
Status Not validated
Chromosome2
Chromosomal Location74668310-74671599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74668488 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 60 (A60E)
Ref Sequence ENSEMBL: ENSMUSP00000001872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001872
AA Change: A60E

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819
AA Change: A60E

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit abnormalities of the axial skeleton, especially limbs, and of the male accessory organs, and agenesis of the preputial glands. Mutant males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,891 F395L possibly damaging Het
Amigo1 C T 3: 108,188,445 T420I probably damaging Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Cald1 C T 6: 34,745,719 R107C probably damaging Het
Cast C T 13: 74,724,837 E444K probably damaging Het
Crybg1 T G 10: 43,999,162 N650T possibly damaging Het
Cyp19a1 T A 9: 54,168,741 R276S possibly damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Gm6588 A G 5: 112,450,511 E308G probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Igkv3-7 G T 6: 70,607,939 G88C probably damaging Het
Kcnk12 GGCATCGC GGCATCGCATCGC 17: 87,746,156 probably null Het
Klhl30 C A 1: 91,354,108 Q144K probably benign Het
Kprp A T 3: 92,823,968 S592T probably damaging Het
Man2c1 T C 9: 57,140,305 probably null Het
Mbtps1 A T 8: 119,541,652 M260K probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Mtcl1 T C 17: 66,366,481 T767A probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nomo1 T C 7: 46,033,896 I22T probably benign Het
Olfr845 T G 9: 19,338,644 F61L probably benign Het
Plin4 A G 17: 56,102,113 V1369A probably benign Het
Polr3c A T 3: 96,715,244 F365Y probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sema4f G A 6: 82,917,906 T436M probably benign Het
Sf3a2 A G 10: 80,801,341 T37A probably damaging Het
Slc1a6 A G 10: 78,787,889 M41V probably benign Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Sspo T C 6: 48,456,994 L911P probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Syne2 A T 12: 75,931,079 I1433F probably damaging Het
Synm C T 7: 67,734,657 V644I possibly damaging Het
Tbc1d5 A G 17: 50,920,587 L210P probably damaging Het
Trak1 T C 9: 121,448,843 Y229H probably damaging Het
Unc5b G T 10: 60,774,700 T446K probably damaging Het
Wdr95 C A 5: 149,597,575 D604E probably benign Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Hoxd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Hoxd13 APN 2 74670096 missense probably damaging 1.00
R1722:Hoxd13 UTSW 2 74670045 missense probably benign 0.34
R2163:Hoxd13 UTSW 2 74669069 missense possibly damaging 0.82
R4400:Hoxd13 UTSW 2 74670015 missense probably damaging 1.00
R4424:Hoxd13 UTSW 2 74669957 nonsense probably null
R4938:Hoxd13 UTSW 2 74668683 missense probably benign 0.26
R5535:Hoxd13 UTSW 2 74668797 missense probably damaging 0.99
R7054:Hoxd13 UTSW 2 74669025 missense probably damaging 1.00
R7069:Hoxd13 UTSW 2 74669024 missense probably damaging 1.00
R7677:Hoxd13 UTSW 2 74668565 missense probably benign 0.39
R8329:Hoxd13 UTSW 2 74668317 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTATAAACGTCCCGCGATGAGC -3'
(R):5'- AAGTGGTAGCCATAGCCCAG -3'

Sequencing Primer
(F):5'- CGCGATGAGCTAACCTGTTG -3'
(R):5'- ACTCTTTGGCCACAGGA -3'
Posted On2015-05-14