Incidental Mutation 'R4116:Zfp773'
ID314632
Institutional Source Beutler Lab
Gene Symbol Zfp773
Ensembl Gene ENSMUSG00000063535
Gene Namezinc finger protein 773
Synonyms2810409K11Rik
MMRRC Submission 040859-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4116 (G1)
Quality Score109
Status Not validated
Chromosome7
Chromosomal Location7127073-7136755 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) AGCTGCTGCTGCTGCTGCTGCTGCTGC to AGCTGCTGCTGCTGCTGCTGCTGC at 7133093 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032622] [ENSMUST00000211240]
Predicted Effect probably benign
Transcript: ENSMUST00000032622
SMART Domains Protein: ENSMUSP00000032622
Gene: ENSMUSG00000063535

DomainStartEndE-ValueType
KRAB 75 134 6.82e-8 SMART
ZnF_C2H2 241 263 1.31e0 SMART
ZnF_C2H2 269 291 1.5e-4 SMART
ZnF_C2H2 297 319 4.17e-3 SMART
ZnF_C2H2 325 347 2.05e-2 SMART
ZnF_C2H2 353 375 2.24e-3 SMART
ZnF_C2H2 381 403 8.81e-2 SMART
ZnF_C2H2 409 431 7.26e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211240
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,891 F395L possibly damaging Het
Amigo1 C T 3: 108,188,445 T420I probably damaging Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Cald1 C T 6: 34,745,719 R107C probably damaging Het
Cast C T 13: 74,724,837 E444K probably damaging Het
Crybg1 T G 10: 43,999,162 N650T possibly damaging Het
Cyp19a1 T A 9: 54,168,741 R276S possibly damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Gm6588 A G 5: 112,450,511 E308G probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Hoxd13 C A 2: 74,668,488 A60E possibly damaging Het
Igkv3-7 G T 6: 70,607,939 G88C probably damaging Het
Kcnk12 GGCATCGC GGCATCGCATCGC 17: 87,746,156 probably null Het
Klhl30 C A 1: 91,354,108 Q144K probably benign Het
Kprp A T 3: 92,823,968 S592T probably damaging Het
Man2c1 T C 9: 57,140,305 probably null Het
Mbtps1 A T 8: 119,541,652 M260K probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Mtcl1 T C 17: 66,366,481 T767A probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nomo1 T C 7: 46,033,896 I22T probably benign Het
Olfr845 T G 9: 19,338,644 F61L probably benign Het
Plin4 A G 17: 56,102,113 V1369A probably benign Het
Polr3c A T 3: 96,715,244 F365Y probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sema4f G A 6: 82,917,906 T436M probably benign Het
Sf3a2 A G 10: 80,801,341 T37A probably damaging Het
Slc1a6 A G 10: 78,787,889 M41V probably benign Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Sspo T C 6: 48,456,994 L911P probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Syne2 A T 12: 75,931,079 I1433F probably damaging Het
Synm C T 7: 67,734,657 V644I possibly damaging Het
Tbc1d5 A G 17: 50,920,587 L210P probably damaging Het
Trak1 T C 9: 121,448,843 Y229H probably damaging Het
Unc5b G T 10: 60,774,700 T446K probably damaging Het
Wdr95 C A 5: 149,597,575 D604E probably benign Het
Other mutations in Zfp773
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Zfp773 APN 7 7132684 missense probably damaging 1.00
IGL00780:Zfp773 APN 7 7133114 missense probably benign 0.00
IGL01348:Zfp773 APN 7 7135315 missense possibly damaging 0.93
IGL02224:Zfp773 APN 7 7132976 missense probably benign 0.00
IGL02447:Zfp773 APN 7 7136656 utr 5 prime probably benign
IGL02869:Zfp773 APN 7 7134233 missense probably benign 0.22
R0505:Zfp773 UTSW 7 7133024 missense probably benign 0.03
R0585:Zfp773 UTSW 7 7132575 missense probably benign 0.21
R0804:Zfp773 UTSW 7 7133093 intron probably benign
R0846:Zfp773 UTSW 7 7132692 missense probably damaging 1.00
R1179:Zfp773 UTSW 7 7133093 intron probably benign
R2847:Zfp773 UTSW 7 7133093 intron probably benign
R3841:Zfp773 UTSW 7 7132391 missense possibly damaging 0.92
R4638:Zfp773 UTSW 7 7135336 missense probably damaging 1.00
R5126:Zfp773 UTSW 7 7136624 missense unknown
R6142:Zfp773 UTSW 7 7132482 missense probably benign 0.00
R7072:Zfp773 UTSW 7 7132875 missense probably benign 0.15
R7232:Zfp773 UTSW 7 7132985 missense probably benign 0.14
R7748:Zfp773 UTSW 7 7132908 missense probably benign 0.04
R7888:Zfp773 UTSW 7 7132979 missense probably benign 0.00
R7971:Zfp773 UTSW 7 7132979 missense probably benign 0.00
RF007:Zfp773 UTSW 7 7132690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCACAGTCGTAACATTTGC -3'
(R):5'- AGAAATCTCGGGTGTTGATTGC -3'

Sequencing Primer
(F):5'- GCCACAGTCGTAACATTTGCAATTC -3'
(R):5'- CTTGTGTTTGTTGCCACTTCAAAG -3'
Posted On2015-05-14