Incidental Mutation 'R4116:Olfr845'
ID314638
Institutional Source Beutler Lab
Gene Symbol Olfr845
Ensembl Gene ENSMUSG00000061614
Gene Nameolfactory receptor 845
SynonymsOlfr1522-ps1, MOR150-2, MOR150-1P, GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-1
MMRRC Submission 040859-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R4116 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19336457-19341718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19338644 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 61 (F61L)
Ref Sequence ENSEMBL: ENSMUSP00000150474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071259] [ENSMUST00000213344] [ENSMUST00000215572]
Predicted Effect probably benign
Transcript: ENSMUST00000071259
AA Change: F61L

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071239
Gene: ENSMUSG00000061614
AA Change: F61L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212246
AA Change: F61L
Predicted Effect probably benign
Transcript: ENSMUST00000213344
AA Change: F61L

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215572
AA Change: F61L

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,891 F395L possibly damaging Het
Amigo1 C T 3: 108,188,445 T420I probably damaging Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Cald1 C T 6: 34,745,719 R107C probably damaging Het
Cast C T 13: 74,724,837 E444K probably damaging Het
Crybg1 T G 10: 43,999,162 N650T possibly damaging Het
Cyp19a1 T A 9: 54,168,741 R276S possibly damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Gm6588 A G 5: 112,450,511 E308G probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Hoxd13 C A 2: 74,668,488 A60E possibly damaging Het
Igkv3-7 G T 6: 70,607,939 G88C probably damaging Het
Kcnk12 GGCATCGC GGCATCGCATCGC 17: 87,746,156 probably null Het
Klhl30 C A 1: 91,354,108 Q144K probably benign Het
Kprp A T 3: 92,823,968 S592T probably damaging Het
Man2c1 T C 9: 57,140,305 probably null Het
Mbtps1 A T 8: 119,541,652 M260K probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Mtcl1 T C 17: 66,366,481 T767A probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nomo1 T C 7: 46,033,896 I22T probably benign Het
Plin4 A G 17: 56,102,113 V1369A probably benign Het
Polr3c A T 3: 96,715,244 F365Y probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sema4f G A 6: 82,917,906 T436M probably benign Het
Sf3a2 A G 10: 80,801,341 T37A probably damaging Het
Slc1a6 A G 10: 78,787,889 M41V probably benign Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Sspo T C 6: 48,456,994 L911P probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Syne2 A T 12: 75,931,079 I1433F probably damaging Het
Synm C T 7: 67,734,657 V644I possibly damaging Het
Tbc1d5 A G 17: 50,920,587 L210P probably damaging Het
Trak1 T C 9: 121,448,843 Y229H probably damaging Het
Unc5b G T 10: 60,774,700 T446K probably damaging Het
Wdr95 C A 5: 149,597,575 D604E probably benign Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Olfr845
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr845 APN 9 19338772 missense possibly damaging 0.56
IGL01637:Olfr845 APN 9 19338964 missense probably damaging 1.00
IGL01767:Olfr845 APN 9 19339302 missense possibly damaging 0.54
IGL01945:Olfr845 APN 9 19339332 missense probably damaging 0.98
IGL02202:Olfr845 APN 9 19339249 missense probably benign 0.06
IGL02877:Olfr845 APN 9 19339201 missense possibly damaging 0.86
R0466:Olfr845 UTSW 9 19339179 missense probably damaging 1.00
R1521:Olfr845 UTSW 9 19338652 missense probably benign 0.35
R1650:Olfr845 UTSW 9 19338647 missense possibly damaging 0.49
R1766:Olfr845 UTSW 9 19338858 missense probably benign 0.06
R2060:Olfr845 UTSW 9 19339056 missense probably benign 0.01
R2082:Olfr845 UTSW 9 19339278 missense probably benign 0.36
R2257:Olfr845 UTSW 9 19338493 missense probably benign 0.01
R2892:Olfr845 UTSW 9 19338738 missense probably benign 0.04
R3156:Olfr845 UTSW 9 19339424 unclassified probably null
R3943:Olfr845 UTSW 9 19339075 missense probably benign 0.05
R4518:Olfr845 UTSW 9 19339260 missense possibly damaging 0.86
R4814:Olfr845 UTSW 9 19339180 missense probably damaging 1.00
R5339:Olfr845 UTSW 9 19339159 missense possibly damaging 0.78
R6647:Olfr845 UTSW 9 19338629 missense possibly damaging 0.50
R7493:Olfr845 UTSW 9 19338813 missense probably damaging 0.98
R7522:Olfr845 UTSW 9 19338998 nonsense probably null
R7584:Olfr845 UTSW 9 19339273 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTCCACAAGTCTCCTAATTAACATGG -3'
(R):5'- ATGGCCACATAGCGGTCATAG -3'

Sequencing Primer
(F):5'- GTCTCCTAATTAACATGGAATCCAC -3'
(R):5'- TCATAGGCCATTGCTGCAAG -3'
Posted On2015-05-14