Incidental Mutation 'R4116:Mpped1'
ID314652
Institutional Source Beutler Lab
Gene Symbol Mpped1
Ensembl Gene ENSMUSG00000041708
Gene Namemetallophosphoesterase domain containing 1
Synonyms
MMRRC Submission 040859-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4116 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location83779467-83858494 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 83796709 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046168] [ENSMUST00000109469] [ENSMUST00000109470] [ENSMUST00000123387] [ENSMUST00000163723] [ENSMUST00000172115] [ENSMUST00000172398]
Predicted Effect probably benign
Transcript: ENSMUST00000046168
SMART Domains Protein: ENSMUSP00000041981
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
Pfam:Metallophos 90 288 1e-13 PFAM
Pfam:Metallophos_2 91 314 8.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109469
Predicted Effect probably benign
Transcript: ENSMUST00000109470
SMART Domains Protein: ENSMUSP00000105096
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
Pfam:Metallophos 90 288 1.9e-13 PFAM
Pfam:Metallophos_2 91 318 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123387
SMART Domains Protein: ENSMUSP00000123230
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 137 2e-54 PDB
Predicted Effect unknown
Transcript: ENSMUST00000150489
AA Change: R43G
SMART Domains Protein: ENSMUSP00000128786
Gene: ENSMUSG00000041708
AA Change: R43G

DomainStartEndE-ValueType
Pfam:Metallophos 87 217 6.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163723
SMART Domains Protein: ENSMUSP00000126242
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
Pfam:Metallophos 5 130 3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171560
SMART Domains Protein: ENSMUSP00000125835
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
Pfam:Metallophos 7 147 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172115
SMART Domains Protein: ENSMUSP00000132518
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 136 1e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172398
SMART Domains Protein: ENSMUSP00000131333
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 140 2e-47 PDB
SCOP:d4kbpa2 84 133 9e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,891 F395L possibly damaging Het
Amigo1 C T 3: 108,188,445 T420I probably damaging Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Cald1 C T 6: 34,745,719 R107C probably damaging Het
Cast C T 13: 74,724,837 E444K probably damaging Het
Crybg1 T G 10: 43,999,162 N650T possibly damaging Het
Cyp19a1 T A 9: 54,168,741 R276S possibly damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Gm6588 A G 5: 112,450,511 E308G probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Hoxd13 C A 2: 74,668,488 A60E possibly damaging Het
Igkv3-7 G T 6: 70,607,939 G88C probably damaging Het
Kcnk12 GGCATCGC GGCATCGCATCGC 17: 87,746,156 probably null Het
Klhl30 C A 1: 91,354,108 Q144K probably benign Het
Kprp A T 3: 92,823,968 S592T probably damaging Het
Man2c1 T C 9: 57,140,305 probably null Het
Mbtps1 A T 8: 119,541,652 M260K probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mtcl1 T C 17: 66,366,481 T767A probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nomo1 T C 7: 46,033,896 I22T probably benign Het
Olfr845 T G 9: 19,338,644 F61L probably benign Het
Plin4 A G 17: 56,102,113 V1369A probably benign Het
Polr3c A T 3: 96,715,244 F365Y probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sema4f G A 6: 82,917,906 T436M probably benign Het
Sf3a2 A G 10: 80,801,341 T37A probably damaging Het
Slc1a6 A G 10: 78,787,889 M41V probably benign Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Sspo T C 6: 48,456,994 L911P probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Syne2 A T 12: 75,931,079 I1433F probably damaging Het
Synm C T 7: 67,734,657 V644I possibly damaging Het
Tbc1d5 A G 17: 50,920,587 L210P probably damaging Het
Trak1 T C 9: 121,448,843 Y229H probably damaging Het
Unc5b G T 10: 60,774,700 T446K probably damaging Het
Wdr95 C A 5: 149,597,575 D604E probably benign Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Mpped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Mpped1 APN 15 83800119 missense probably damaging 1.00
IGL01402:Mpped1 APN 15 83792213 missense possibly damaging 0.94
IGL02004:Mpped1 APN 15 83800156 missense probably damaging 1.00
R0336:Mpped1 UTSW 15 83836282 missense probably damaging 1.00
R1582:Mpped1 UTSW 15 83791990 unclassified probably benign
R1635:Mpped1 UTSW 15 83791990 unclassified probably benign
R1636:Mpped1 UTSW 15 83791990 unclassified probably benign
R1637:Mpped1 UTSW 15 83791990 unclassified probably benign
R1778:Mpped1 UTSW 15 83791990 unclassified probably benign
R3787:Mpped1 UTSW 15 83796583 intron probably benign
R4114:Mpped1 UTSW 15 83796709 intron probably benign
R4977:Mpped1 UTSW 15 83796706 intron probably benign
R4982:Mpped1 UTSW 15 83836327 missense probably damaging 1.00
R6352:Mpped1 UTSW 15 83836363 missense probably damaging 1.00
R6765:Mpped1 UTSW 15 83836383 missense probably damaging 1.00
R7499:Mpped1 UTSW 15 83800050 missense probably damaging 1.00
R8056:Mpped1 UTSW 15 83836462 missense possibly damaging 0.63
R8395:Mpped1 UTSW 15 83800056 missense probably damaging 1.00
R8956:Mpped1 UTSW 15 83856268 missense probably damaging 1.00
R8959:Mpped1 UTSW 15 83792141 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGAGCTACAGCATGGAGG -3'
(R):5'- GCATAGACTGAGCAGTGTCTC -3'

Sequencing Primer
(F):5'- AGAGTGTGCCATCCCAGCTG -3'
(R):5'- TCAGGGAGAGGCTACTTCAC -3'
Posted On2015-05-14