Incidental Mutation 'R4116:Abcc10'
ID314655
Institutional Source Beutler Lab
Gene Symbol Abcc10
Ensembl Gene ENSMUSG00000032842
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 10
SynonymsMrp7
MMRRC Submission 040859-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4116 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46303221-46328352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46323891 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 395 (F395L)
Ref Sequence ENSEMBL: ENSMUSP00000132561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000095261] [ENSMUST00000167360] [ENSMUST00000168490] [ENSMUST00000171584]
Predicted Effect probably benign
Transcript: ENSMUST00000047970
AA Change: F395L

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842
AA Change: F395L

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095261
AA Change: F354L

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842
AA Change: F354L

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165733
Predicted Effect probably benign
Transcript: ENSMUST00000167360
AA Change: F395L

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842
AA Change: F395L

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168490
SMART Domains Protein: ENSMUSP00000132760
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
AAA 75 242 4.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170168
Predicted Effect possibly damaging
Transcript: ENSMUST00000171584
AA Change: F395L

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842
AA Change: F395L

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homzozygous for a knock-out allele exhibit increased sensitivity to paclitaxel-induced mortality associated with weight loss, decreased white blood cell, and small spleen and thymus cortex due to apoptosis and/or depopulation of lymphoid cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo1 C T 3: 108,188,445 T420I probably damaging Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Cald1 C T 6: 34,745,719 R107C probably damaging Het
Cast C T 13: 74,724,837 E444K probably damaging Het
Crybg1 T G 10: 43,999,162 N650T possibly damaging Het
Cyp19a1 T A 9: 54,168,741 R276S possibly damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Gm6588 A G 5: 112,450,511 E308G probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Hoxd13 C A 2: 74,668,488 A60E possibly damaging Het
Igkv3-7 G T 6: 70,607,939 G88C probably damaging Het
Kcnk12 GGCATCGC GGCATCGCATCGC 17: 87,746,156 probably null Het
Klhl30 C A 1: 91,354,108 Q144K probably benign Het
Kprp A T 3: 92,823,968 S592T probably damaging Het
Man2c1 T C 9: 57,140,305 probably null Het
Mbtps1 A T 8: 119,541,652 M260K probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Mtcl1 T C 17: 66,366,481 T767A probably benign Het
Nek5 G A 8: 22,111,162 T181M probably damaging Het
Nomo1 T C 7: 46,033,896 I22T probably benign Het
Olfr845 T G 9: 19,338,644 F61L probably benign Het
Plin4 A G 17: 56,102,113 V1369A probably benign Het
Polr3c A T 3: 96,715,244 F365Y probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sema4f G A 6: 82,917,906 T436M probably benign Het
Sf3a2 A G 10: 80,801,341 T37A probably damaging Het
Slc1a6 A G 10: 78,787,889 M41V probably benign Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Sspo T C 6: 48,456,994 L911P probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Syne2 A T 12: 75,931,079 I1433F probably damaging Het
Synm C T 7: 67,734,657 V644I possibly damaging Het
Tbc1d5 A G 17: 50,920,587 L210P probably damaging Het
Trak1 T C 9: 121,448,843 Y229H probably damaging Het
Unc5b G T 10: 60,774,700 T446K probably damaging Het
Wdr95 C A 5: 149,597,575 D604E probably benign Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Abcc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Abcc10 APN 17 46323745 missense probably damaging 1.00
IGL01115:Abcc10 APN 17 46310426 missense probably benign
IGL01380:Abcc10 APN 17 46324022 missense possibly damaging 0.90
IGL01476:Abcc10 APN 17 46327937 utr 5 prime probably benign
IGL01723:Abcc10 APN 17 46313745 missense probably damaging 1.00
IGL01867:Abcc10 APN 17 46324438 missense probably benign 0.07
IGL02065:Abcc10 APN 17 46312901 missense possibly damaging 0.60
IGL02233:Abcc10 APN 17 46324159 splice site probably null
IGL03394:Abcc10 APN 17 46324351 missense probably damaging 1.00
Decrepit UTSW 17 46324391 missense probably damaging 1.00
Shrivelled UTSW 17 46312419 missense probably benign
PIT4514001:Abcc10 UTSW 17 46305648 missense probably benign
R0366:Abcc10 UTSW 17 46324798 nonsense probably null
R0437:Abcc10 UTSW 17 46312919 splice site probably null
R0437:Abcc10 UTSW 17 46312920 splice site probably benign
R0549:Abcc10 UTSW 17 46322290 missense probably damaging 1.00
R0580:Abcc10 UTSW 17 46305956 splice site probably null
R1056:Abcc10 UTSW 17 46303954 missense possibly damaging 0.60
R1426:Abcc10 UTSW 17 46324435 missense probably damaging 0.97
R1595:Abcc10 UTSW 17 46322238 missense probably damaging 1.00
R1745:Abcc10 UTSW 17 46312433 missense probably benign
R1856:Abcc10 UTSW 17 46306603 missense probably damaging 1.00
R1968:Abcc10 UTSW 17 46322199 missense probably damaging 1.00
R2070:Abcc10 UTSW 17 46303565 missense probably benign
R2071:Abcc10 UTSW 17 46303565 missense probably benign
R2255:Abcc10 UTSW 17 46305635 missense probably benign 0.18
R2425:Abcc10 UTSW 17 46310157 missense probably damaging 1.00
R4510:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4511:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4645:Abcc10 UTSW 17 46324774 missense probably damaging 1.00
R4689:Abcc10 UTSW 17 46324070 missense probably benign 0.00
R4778:Abcc10 UTSW 17 46304416 missense probably damaging 1.00
R5364:Abcc10 UTSW 17 46305651 missense probably benign 0.25
R5384:Abcc10 UTSW 17 46304435 missense possibly damaging 0.83
R5509:Abcc10 UTSW 17 46324259 missense probably benign 0.01
R5568:Abcc10 UTSW 17 46303908 splice site probably null
R5798:Abcc10 UTSW 17 46306003 nonsense probably null
R5906:Abcc10 UTSW 17 46316559 missense probably benign 0.02
R5908:Abcc10 UTSW 17 46313804 missense probably damaging 1.00
R5942:Abcc10 UTSW 17 46312407 missense probably benign 0.02
R5968:Abcc10 UTSW 17 46310151 missense probably benign
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6109:Abcc10 UTSW 17 46310377 missense probably benign 0.00
R6623:Abcc10 UTSW 17 46323462 missense probably damaging 1.00
R6851:Abcc10 UTSW 17 46312419 missense probably benign
R6927:Abcc10 UTSW 17 46324391 missense probably damaging 1.00
R7176:Abcc10 UTSW 17 46324277 missense probably benign 0.02
R7314:Abcc10 UTSW 17 46315404 missense probably damaging 0.98
R7463:Abcc10 UTSW 17 46323772 missense probably damaging 1.00
R7527:Abcc10 UTSW 17 46312904 missense possibly damaging 0.58
R7584:Abcc10 UTSW 17 46315378 splice site probably null
R7862:Abcc10 UTSW 17 46315532 nonsense probably null
R7883:Abcc10 UTSW 17 46307101 missense probably benign 0.03
R7896:Abcc10 UTSW 17 46324309 missense probably benign 0.08
R7897:Abcc10 UTSW 17 46324073 missense probably benign 0.00
R8316:Abcc10 UTSW 17 46327809 missense probably damaging 0.99
R8354:Abcc10 UTSW 17 46324177 missense possibly damaging 0.75
R8414:Abcc10 UTSW 17 46312347 missense probably benign 0.28
R8454:Abcc10 UTSW 17 46324177 missense possibly damaging 0.75
X0020:Abcc10 UTSW 17 46324120 missense probably damaging 0.98
Z1176:Abcc10 UTSW 17 46313700 missense probably damaging 0.97
Z1176:Abcc10 UTSW 17 46324262 missense probably benign 0.00
Z1177:Abcc10 UTSW 17 46307062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCATCTCCTGGTTGCTG -3'
(R):5'- AAGGTCAAGAGCCTCTAAGCC -3'

Sequencing Primer
(F):5'- CCTGGTTGCTGGCCATGATTC -3'
(R):5'- TAAGCCACGGCCTGCTCTATG -3'
Posted On2015-05-14