Incidental Mutation 'R4131:Psmd1'
ID314663
Institutional Source Beutler Lab
Gene Symbol Psmd1
Ensembl Gene ENSMUSG00000026229
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 1
SynonymsS1, P112
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86064387-86139151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86078700 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 263 (S263P)
Ref Sequence ENSEMBL: ENSMUSP00000027432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027432] [ENSMUST00000139715]
Predicted Effect probably damaging
Transcript: ENSMUST00000027432
AA Change: S263P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229
AA Change: S263P

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127104
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Meta Mutation Damage Score 0.1501 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: In eukaryotic cells, most proteins in the cytosol and nucleus are degraded via the ubiquitin-proteasome pathway. The 26S proteasome is a self-compartmentalizing protease comprised of approximately 31 different subunits. It contains a barrel-shaped proteolytic core complex (the 20S proteasome), capped at one or both ends by 19S regulatory complexes, which recognize ubiquitinated proteins. Protein degradation by proteasomes is the source of most antigenic peptides presented on MHC class I molecules. This gene encodes a non-ATPase subunit of the 26S proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Psmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Psmd1 APN 1 86090198 splice site probably benign
IGL02410:Psmd1 APN 1 86077437 missense probably damaging 0.97
IGL02455:Psmd1 APN 1 86078580 missense probably damaging 0.97
IGL03015:Psmd1 APN 1 86128192 missense probably damaging 0.97
IGL03100:Psmd1 APN 1 86118521 missense possibly damaging 0.68
Rickety UTSW 1 86070628 critical splice donor site probably null
PIT4480001:Psmd1 UTSW 1 86128238 missense probably damaging 0.99
R0027:Psmd1 UTSW 1 86094265 splice site probably benign
R0115:Psmd1 UTSW 1 86083271 missense possibly damaging 0.89
R0201:Psmd1 UTSW 1 86118616 missense probably benign 0.11
R0206:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0208:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0255:Psmd1 UTSW 1 86078582 missense probably damaging 1.00
R0486:Psmd1 UTSW 1 86094290 missense probably damaging 0.99
R0675:Psmd1 UTSW 1 86082039 missense probably benign 0.03
R0790:Psmd1 UTSW 1 86077450 missense possibly damaging 0.94
R1565:Psmd1 UTSW 1 86091997 splice site probably benign
R1721:Psmd1 UTSW 1 86071845 missense probably damaging 0.99
R2010:Psmd1 UTSW 1 86075997 missense probably damaging 0.96
R2098:Psmd1 UTSW 1 86082101 splice site probably null
R2118:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2119:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2120:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2122:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2504:Psmd1 UTSW 1 86089997 missense possibly damaging 0.91
R3810:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R3811:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R3978:Psmd1 UTSW 1 86128187 missense probably benign 0.05
R4360:Psmd1 UTSW 1 86133737 missense probably damaging 0.97
R4386:Psmd1 UTSW 1 86128192 missense possibly damaging 0.93
R4402:Psmd1 UTSW 1 86075951 missense possibly damaging 0.59
R4591:Psmd1 UTSW 1 86128204 missense probably benign 0.05
R4783:Psmd1 UTSW 1 86078712 missense probably damaging 0.97
R4824:Psmd1 UTSW 1 86137098 missense probably benign 0.08
R4937:Psmd1 UTSW 1 86083225 missense probably damaging 0.98
R5443:Psmd1 UTSW 1 86090183 missense probably damaging 0.99
R5486:Psmd1 UTSW 1 86137050 missense possibly damaging 0.59
R5979:Psmd1 UTSW 1 86090053 missense possibly damaging 0.92
R6033:Psmd1 UTSW 1 86137095 missense probably damaging 1.00
R6425:Psmd1 UTSW 1 86070628 critical splice donor site probably null
R7467:Psmd1 UTSW 1 86116633 missense probably damaging 0.99
R8257:Psmd1 UTSW 1 86078623 missense probably damaging 0.99
R8390:Psmd1 UTSW 1 86078607 missense possibly damaging 0.59
Z1177:Psmd1 UTSW 1 86083168 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGAATAGAATGCTAGGCTAGAGAC -3'
(R):5'- TGAAGATCCCACTGACTCCC -3'

Sequencing Primer
(F):5'- CCCTTGCAGATGAAGTTTTCAG -3'
(R):5'- TGACTCCCCAGATGAATACAGATGTG -3'
Posted On2015-05-14