Incidental Mutation 'R4131:Nup35'
ID314664
Institutional Source Beutler Lab
Gene Symbol Nup35
Ensembl Gene ENSMUSG00000026999
Gene Namenucleoporin 35
Synonyms2310006I24Rik, 5330402E05Rik
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location80617236-80658906 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 80656099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028382] [ENSMUST00000124377]
Predicted Effect probably benign
Transcript: ENSMUST00000028382
SMART Domains Protein: ENSMUSP00000028382
Gene: ENSMUSG00000026999

DomainStartEndE-ValueType
Pfam:Nup35_RRM 166 251 8.2e-30 PFAM
Pfam:Nup35_RRM_2 172 224 9.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124377
SMART Domains Protein: ENSMUSP00000122132
Gene: ENSMUSG00000026999

DomainStartEndE-ValueType
PDB:4LIR|B 150 179 3e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135305
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family. The encoded protein contains two membrane binding regions, is localized to the nuclear rim, and is part of the nuclear pore complex. All molecules entering or leaving the nucleus either diffuse through or are actively transported by the nuclear pore complex. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 7 and 10. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout through a point mutation in a critical functional domain leads to early death as a result of megacolon caused by colon myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Nup35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Nup35 APN 2 80654832 missense probably damaging 1.00
IGL02039:Nup35 APN 2 80642775 missense probably benign 0.04
IGL02538:Nup35 APN 2 80644219 missense possibly damaging 0.83
IGL03167:Nup35 APN 2 80658316 unclassified probably benign
R0540:Nup35 UTSW 2 80642640 missense probably benign 0.11
R0607:Nup35 UTSW 2 80642640 missense probably benign 0.11
R4029:Nup35 UTSW 2 80652974 missense probably benign 0.04
R4050:Nup35 UTSW 2 80655976 missense probably benign 0.30
R4130:Nup35 UTSW 2 80656099 unclassified probably benign
R4477:Nup35 UTSW 2 80657143 unclassified probably benign
R6374:Nup35 UTSW 2 80658386 missense probably benign 0.00
R7191:Nup35 UTSW 2 80658379 missense probably damaging 1.00
R7723:Nup35 UTSW 2 80656031 missense possibly damaging 0.81
R8077:Nup35 UTSW 2 80638936 splice site probably null
Predicted Primers PCR Primer
(F):5'- AATGCACGTCAATTTTGTCCTC -3'
(R):5'- AGTACTACTCCACACAAGTTACCTTTC -3'

Sequencing Primer
(F):5'- GCACGTCAATTTTGTCCTCATGTTTG -3'
(R):5'- CCATTTCACAAACTAGGGAAA -3'
Posted On2015-05-14