Incidental Mutation 'R4131:Cmklr1'
ID314670
Institutional Source Beutler Lab
Gene Symbol Cmklr1
Ensembl Gene ENSMUSG00000042190
Gene Namechemokine-like receptor 1
SynonymsChemR23, Gpcr27
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location113612354-113650426 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 113614484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 152 (R152L)
Ref Sequence ENSEMBL: ENSMUSP00000121765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047936] [ENSMUST00000132065] [ENSMUST00000142854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047936
AA Change: R152L

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036316
Gene: ENSMUSG00000042190
AA Change: R152L

DomainStartEndE-ValueType
Pfam:7tm_1 55 314 2.6e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132065
AA Change: R152L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121765
Gene: ENSMUSG00000042190
AA Change: R152L

DomainStartEndE-ValueType
Pfam:7tm_1 55 301 5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142854
Meta Mutation Damage Score 0.4712 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous null mice have defects in immunomodulation of monocyte and neutriphils by chemerin [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Cmklr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Cmklr1 APN 5 113614221 missense probably benign 0.04
IGL02246:Cmklr1 APN 5 113614400 missense probably benign 0.00
IGL02997:Cmklr1 APN 5 113614640 missense probably benign 0.15
R0098:Cmklr1 UTSW 5 113614470 missense probably benign 0.00
R0360:Cmklr1 UTSW 5 113614517 missense probably damaging 1.00
R0364:Cmklr1 UTSW 5 113614517 missense probably damaging 1.00
R1217:Cmklr1 UTSW 5 113614046 missense probably damaging 1.00
R1702:Cmklr1 UTSW 5 113613842 missense probably benign 0.20
R1862:Cmklr1 UTSW 5 113614407 missense probably damaging 0.96
R4132:Cmklr1 UTSW 5 113614484 missense probably damaging 0.97
R4611:Cmklr1 UTSW 5 113614869 missense probably benign 0.05
R4647:Cmklr1 UTSW 5 113614640 missense probably damaging 1.00
R5217:Cmklr1 UTSW 5 113614649 missense probably damaging 0.98
R5484:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5486:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5487:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5504:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5505:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R6301:Cmklr1 UTSW 5 113614938 start codon destroyed possibly damaging 0.72
R6994:Cmklr1 UTSW 5 113614922 missense probably damaging 1.00
R7342:Cmklr1 UTSW 5 113614293 missense probably benign 0.00
Z1176:Cmklr1 UTSW 5 113613891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAAACTACTTGCGAGTGG -3'
(R):5'- TTTGTCAACCTGGCTGTGGC -3'

Sequencing Primer
(F):5'- ACTTGCGAGTGGGCGGG -3'
(R):5'- GATGCACATCACCTACGCGG -3'
Posted On2015-05-14