Incidental Mutation 'R4131:Try4'
ID314671
Institutional Source Beutler Lab
Gene Symbol Try4
Ensembl Gene ENSMUSG00000054106
Gene Nametrypsin 4
Synonyms0910001B19Rik, Td
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41302269-41305532 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 41305401 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 218 (Y218*)
Ref Sequence ENSEMBL: ENSMUSP00000031913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031913]
Predicted Effect probably null
Transcript: ENSMUST00000031913
AA Change: Y218*
SMART Domains Protein: ENSMUSP00000031913
Gene: ENSMUSG00000054106
AA Change: Y218*

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Tryp_SPc 23 239 9.72e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193013
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Try4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Try4 APN 6 41305026 missense probably damaging 1.00
IGL02216:Try4 APN 6 41305031 missense probably benign
R0537:Try4 UTSW 6 41304362 missense probably benign
R0731:Try4 UTSW 6 41304367 missense probably benign 0.01
R1113:Try4 UTSW 6 41305374 missense possibly damaging 0.90
R1833:Try4 UTSW 6 41303431 missense probably damaging 0.98
R2246:Try4 UTSW 6 41305472 missense possibly damaging 0.80
R4414:Try4 UTSW 6 41304971 missense possibly damaging 0.84
R5457:Try4 UTSW 6 41303421 missense probably damaging 1.00
R5707:Try4 UTSW 6 41305043 missense possibly damaging 0.65
R6023:Try4 UTSW 6 41303421 missense probably damaging 1.00
R7131:Try4 UTSW 6 41304403 missense probably benign 0.03
R7783:Try4 UTSW 6 41302295 missense possibly damaging 0.96
R8051:Try4 UTSW 6 41305062 missense probably damaging 0.99
RF007:Try4 UTSW 6 41305363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTCAGCCAGAACAGAGG -3'
(R):5'- GTAGGACGCAAACAACATTTAAACG -3'

Sequencing Primer
(F):5'- CCAGAACAGAGGATGGGCTAACC -3'
(R):5'- TAAGGTATTTCCCACAGACAAAAGG -3'
Posted On2015-05-14