Mutagenetix > Incidental Mutation

Incidental Mutation 'R4131:Grm7'

314672

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

6330570A01Rik, Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik

MMRRC Submission

040994-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4131 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110622542-111544191 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 110623309 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 161 (V161F)

Ref Sequence

ENSEMBL: ENSMUSP00000134635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably damaging
Transcript: ENSMUST00000071076
AA Change: V161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: V161F

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172951
AA Change: V161F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: V161F

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173609

Predicted Effect

probably damaging
Transcript: ENSMUST00000174018
AA Change: V161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: V161F

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Meta Mutation Damage Score

0.2357

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	A	G	9: 99,502,671 (GRCm39)	D277G	possibly damaging	Het
Abca12	A	G	1: 71,359,030 (GRCm39)		probably null	Het
Adam12	C	T	7: 133,514,653 (GRCm39)	V345I	probably damaging	Het
Arpp21	T	A	9: 111,984,376 (GRCm39)		probably benign	Het
Art3	A	T	5: 92,540,421 (GRCm39)	M55L	probably benign	Het
C1d	C	T	11: 17,214,054 (GRCm39)		probably benign	Het
Ces1c	A	G	8: 93,827,312 (GRCm39)	M484T	probably damaging	Het
Cisd3	T	C	11: 97,579,257 (GRCm39)	V133A	possibly damaging	Het
Clpx	A	G	9: 65,223,937 (GRCm39)	I230V	possibly damaging	Het
Cmklr1	C	A	5: 113,752,545 (GRCm39)	R152L	probably damaging	Het
Heca	A	G	10: 17,777,987 (GRCm39)	S537P	probably damaging	Het
Igha	C	A	12: 113,222,449 (GRCm39)		probably benign	Het
Itgb2l	A	G	16: 96,238,589 (GRCm39)	L70P	probably damaging	Het
Klk1b3	T	A	7: 43,851,111 (GRCm39)	N181K	probably damaging	Het
Klra2	T	A	6: 131,205,180 (GRCm39)	R220S	probably benign	Het
Lama2	C	T	10: 26,917,170 (GRCm39)	V2252I	probably benign	Het
Megf10	G	A	18: 57,313,607 (GRCm39)	C17Y	probably damaging	Het
Nup35	G	A	2: 80,486,443 (GRCm39)		probably benign	Het
Or52n4b	C	G	7: 108,143,744 (GRCm39)	S2*	probably null	Het
Or8b37	T	A	9: 37,959,170 (GRCm39)	Y217*	probably null	Het
Pdzd9	A	T	7: 120,262,092 (GRCm39)	D123E	possibly damaging	Het
Phactr1	A	T	13: 43,190,953 (GRCm39)	Q141L	probably damaging	Het
Prelid2	T	G	18: 42,084,224 (GRCm39)	D6A	possibly damaging	Het
Psmd1	T	C	1: 86,006,422 (GRCm39)	S263P	probably damaging	Het
Rassf6	C	T	5: 90,757,646 (GRCm39)	D105N	probably damaging	Het
Ryr3	C	T	2: 112,757,328 (GRCm39)		probably null	Het
Sema4g	T	A	19: 44,987,358 (GRCm39)	F501L	probably benign	Het
Ssrp1	A	G	2: 84,874,791 (GRCm39)	E537G	probably null	Het
Try4	T	A	6: 41,282,335 (GRCm39)	Y218*	probably null	Het
Zbtb40	G	T	4: 136,722,707 (GRCm39)	S790R	probably benign	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111,223,145 (GRCm39)	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111,335,278 (GRCm39)	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111,335,919 (GRCm39)	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111,230,981 (GRCm39)	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111,472,604 (GRCm39)	splice site	probably null
IGL03185:Grm7	APN	6	110,623,183 (GRCm39)	missense	possibly damaging	0.84
Appropriated	UTSW	6	111,472,642 (GRCm39)	missense	possibly damaging	0.64
Consumed	UTSW	6	111,335,836 (GRCm39)	missense	probably damaging	1.00
Devoured	UTSW	6	111,335,785 (GRCm39)	missense	probably damaging	1.00
Ravaged	UTSW	6	111,335,874 (GRCm39)	missense	probably damaging	1.00
shaky	UTSW	6	111,472,752 (GRCm39)	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110,623,050 (GRCm39)	missense	probably benign
R0539:Grm7	UTSW	6	111,336,055 (GRCm39)	splice site	probably benign
R0622:Grm7	UTSW	6	111,335,457 (GRCm39)	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111,335,985 (GRCm39)	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111,335,256 (GRCm39)	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111,472,752 (GRCm39)	nonsense	probably null
R1823:Grm7	UTSW	6	111,184,730 (GRCm39)	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111,057,384 (GRCm39)	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111,335,568 (GRCm39)	missense	probably benign
R1987:Grm7	UTSW	6	110,891,472 (GRCm39)	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111,184,769 (GRCm39)	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110,623,098 (GRCm39)	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111,335,958 (GRCm39)	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111,472,642 (GRCm39)	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111,472,866 (GRCm39)	splice site	probably null
R2923:Grm7	UTSW	6	111,472,866 (GRCm39)	splice site	probably null
R3014:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111,472,683 (GRCm39)	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110,891,301 (GRCm39)	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111,230,981 (GRCm39)	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110,891,325 (GRCm39)	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111,223,335 (GRCm39)	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110,623,309 (GRCm39)	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111,335,265 (GRCm39)	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110,891,507 (GRCm39)	splice site	probably null
R4647:Grm7	UTSW	6	110,891,344 (GRCm39)	nonsense	probably null
R4714:Grm7	UTSW	6	111,057,383 (GRCm39)	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110,891,332 (GRCm39)	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111,335,824 (GRCm39)	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111,057,404 (GRCm39)	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110,623,097 (GRCm39)	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111,335,182 (GRCm39)	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111,335,387 (GRCm39)	missense	probably benign
R6026:Grm7	UTSW	6	111,478,500 (GRCm39)	nonsense	probably null
R6174:Grm7	UTSW	6	111,223,258 (GRCm39)	missense	probably benign
R6305:Grm7	UTSW	6	111,335,626 (GRCm39)	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111,335,836 (GRCm39)	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111,230,981 (GRCm39)	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111,184,713 (GRCm39)	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111,335,386 (GRCm39)	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111,335,314 (GRCm39)	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	111,472,690 (GRCm39)	missense	probably damaging	1.00
R6949:Grm7	UTSW	6	110,623,265 (GRCm39)	missense	probably benign	0.03
R6989:Grm7	UTSW	6	111,184,766 (GRCm39)	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111,335,113 (GRCm39)	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111,335,530 (GRCm39)	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111,335,530 (GRCm39)	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111,335,785 (GRCm39)	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110,623,079 (GRCm39)	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110,622,974 (GRCm39)	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111,478,476 (GRCm39)	missense
R7567:Grm7	UTSW	6	111,335,722 (GRCm39)	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111,223,314 (GRCm39)	nonsense	probably null
R8018:Grm7	UTSW	6	111,184,737 (GRCm39)	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111,543,000 (GRCm39)	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110,891,297 (GRCm39)	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111,057,315 (GRCm39)	missense	probably benign
R8523:Grm7	UTSW	6	111,223,280 (GRCm39)	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111,230,966 (GRCm39)	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111,472,783 (GRCm39)	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111,472,729 (GRCm39)	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111,335,874 (GRCm39)	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110,622,869 (GRCm39)	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111,231,077 (GRCm39)	missense	possibly damaging	0.94
R9448:Grm7	UTSW	6	111,335,193 (GRCm39)	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111,335,451 (GRCm39)	missense	probably damaging	1.00
Z1176:Grm7	UTSW	6	111,335,110 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCTCTCGACCAGATCAACAG -3'
(R):5'- TTCGACAGGATCTCCAGGGTAG -3'

Sequencing Primer
(F):5'- TGCTGCCCAACGTAACG -3'
(R):5'- ATCTCCAGGGTAGAAATGTTGG -3'

Posted On

2015-05-14