Incidental Mutation 'R4131:Klk1b3'
ID314674
Institutional Source Beutler Lab
Gene Symbol Klk1b3
Ensembl Gene ENSMUSG00000066515
Gene Namekallikrein 1-related peptidase b3
SynonymsNgfg, mGk-3, Ngfg
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44198191-44202352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44201687 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 181 (N181K)
Ref Sequence ENSEMBL: ENSMUSP00000082577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085450]
PDB Structure
CRYSTAL STRUCTURE OF 7S NGF: A COMPLEX OF NERVE GROWTH FACTOR WITH FOUR BINDING PROTEINS (SERINE PROTEINASES) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000085450
AA Change: N181K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082577
Gene: ENSMUSG00000066515
AA Change: N181K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 8.28e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206892
Meta Mutation Damage Score 0.4891 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the 7S nerve growth factor (NGF) complex that is essential for the differentiation and survival of distinct populations of neurons in both the central and the peripheral nervous systems. The encoded protein is a glandular kallikrein-type serine protease that processes the beta subunit of NGF. This gene is present in a cluster of multiple related kallikrein-type protease genes on chromosome 7. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Klk1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
delicato UTSW 7 44200404 splice site probably null
fragile UTSW 7 44201687 missense probably damaging 1.00
R1294:Klk1b3 UTSW 7 44200296 missense probably damaging 1.00
R4611:Klk1b3 UTSW 7 44201265 missense possibly damaging 0.84
R6086:Klk1b3 UTSW 7 44201734 missense probably damaging 1.00
R6631:Klk1b3 UTSW 7 44201464 missense probably benign 0.08
R6845:Klk1b3 UTSW 7 44201703 missense probably benign 0.28
R7054:Klk1b3 UTSW 7 44201439 missense probably damaging 0.99
R7215:Klk1b3 UTSW 7 44200404 splice site probably null
Z1088:Klk1b3 UTSW 7 44200305 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGATACTGTGAAGCCCATC -3'
(R):5'- AGTCAGACTGTTGAAGTGGG -3'

Sequencing Primer
(F):5'- GAGCACATGCCTAGCCTCAG -3'
(R):5'- CAAGTGTCTTTGCCTCCA -3'
Posted On2015-05-14