Incidental Mutation 'R4131:Pdzd9'
ID314676
Institutional Source Beutler Lab
Gene Symbol Pdzd9
Ensembl Gene ENSMUSG00000030887
Gene NamePDZ domain containing 9
Synonyms
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120658731-120670343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120662869 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 123 (D123E)
Ref Sequence ENSEMBL: ENSMUSP00000033178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033176] [ENSMUST00000033178] [ENSMUST00000127845] [ENSMUST00000208635]
PDB Structure
The solution structure of RSGI RUH-020, a PDZ domain of hypothetical protein from mouse [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000033176
SMART Domains Protein: ENSMUSP00000033176
Gene: ENSMUSG00000030884

DomainStartEndE-ValueType
Pfam:Peptidase_M16 48 194 3.2e-33 PFAM
Pfam:Peptidase_M16_C 199 378 2.2e-26 PFAM
low complexity region 417 430 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000033178
AA Change: D123E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033178
Gene: ENSMUSG00000030887
AA Change: D123E

DomainStartEndE-ValueType
PDZ 38 111 2.97e-8 SMART
low complexity region 231 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127845
Predicted Effect probably benign
Transcript: ENSMUST00000208635
Meta Mutation Damage Score 0.1210 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Pdzd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pdzd9 APN 7 120660271 missense possibly damaging 0.92
IGL01295:Pdzd9 APN 7 120668395 missense probably damaging 1.00
IGL02252:Pdzd9 APN 7 120663015 missense probably benign 0.00
IGL02393:Pdzd9 APN 7 120662983 nonsense probably null
R0826:Pdzd9 UTSW 7 120668401 missense probably damaging 0.99
R4130:Pdzd9 UTSW 7 120662869 missense possibly damaging 0.81
R4820:Pdzd9 UTSW 7 120668396 missense probably damaging 1.00
R4915:Pdzd9 UTSW 7 120670168 missense possibly damaging 0.82
R5883:Pdzd9 UTSW 7 120668553 missense possibly damaging 0.60
R6283:Pdzd9 UTSW 7 120660226 missense possibly damaging 0.66
R6896:Pdzd9 UTSW 7 120662872 makesense probably null
R7017:Pdzd9 UTSW 7 120663002 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCTGCAGAATGTCCTTTGTAG -3'
(R):5'- TCAGTACAGCTCTTTTCAAGCC -3'

Sequencing Primer
(F):5'- GAAGAATGTCATTCACTAAGCCCTGG -3'
(R):5'- ACAGCTCTTTTCAAGCCATTATTTC -3'
Posted On2015-05-14