Incidental Mutation 'R4131:Ces1c'
ID314677
Institutional Source Beutler Lab
Gene Symbol Ces1c
Ensembl Gene ENSMUSG00000057400
Gene Namecarboxylesterase 1C
SynonymsEs-4, Ces-N, Es1, Es-N, Ee-1, Es-1
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93099015-93131283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93100684 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 484 (M484T)
Ref Sequence ENSEMBL: ENSMUSP00000034189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034189]
Predicted Effect probably damaging
Transcript: ENSMUST00000034189
AA Change: M484T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034189
Gene: ENSMUSG00000057400
AA Change: M484T

DomainStartEndE-ValueType
Pfam:COesterase 1 534 4e-167 PFAM
Pfam:Abhydrolase_3 136 235 6.2e-10 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against nerve agents such as chlorpyrifos and chlorpyrifos oxon but increased sensitivity to soman coumarin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Ces1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ces1c APN 8 93106673 missense probably benign 0.02
IGL00558:Ces1c APN 8 93099271 missense probably benign 0.03
IGL00787:Ces1c APN 8 93120366 missense possibly damaging 0.90
IGL00851:Ces1c APN 8 93123117 missense probably benign 0.00
IGL01598:Ces1c APN 8 93118413 missense probably benign
IGL02616:Ces1c APN 8 93106615 missense probably benign 0.01
IGL03087:Ces1c APN 8 93118414 missense probably benign
IGL03203:Ces1c APN 8 93124588 missense probably damaging 1.00
R0119:Ces1c UTSW 8 93106717 unclassified probably benign
R0119:Ces1c UTSW 8 93107610 missense probably benign 0.00
R0255:Ces1c UTSW 8 93127524 missense probably benign
R0759:Ces1c UTSW 8 93130864 nonsense probably null
R1499:Ces1c UTSW 8 93127605 missense probably benign 0.01
R1926:Ces1c UTSW 8 93127604 missense possibly damaging 0.69
R2087:Ces1c UTSW 8 93107602 missense probably benign 0.00
R2142:Ces1c UTSW 8 93130840 missense probably benign
R2442:Ces1c UTSW 8 93123212 missense probably damaging 1.00
R2971:Ces1c UTSW 8 93104193 missense probably benign 0.01
R3079:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R3080:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R3609:Ces1c UTSW 8 93120332 missense probably damaging 1.00
R4633:Ces1c UTSW 8 93118386 missense probably benign 0.00
R4988:Ces1c UTSW 8 93100708 missense probably damaging 1.00
R5081:Ces1c UTSW 8 93127569 missense probably damaging 1.00
R5497:Ces1c UTSW 8 93130715 missense possibly damaging 0.91
R5586:Ces1c UTSW 8 93127599 missense probably benign 0.00
R7013:Ces1c UTSW 8 93130764 missense probably damaging 1.00
R7137:Ces1c UTSW 8 93130842 missense probably benign 0.02
R7611:Ces1c UTSW 8 93124511 missense probably benign 0.00
R7882:Ces1c UTSW 8 93106603 missense probably benign
R8280:Ces1c UTSW 8 93099181 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGGCTGACAACCTCCATAGAG -3'
(R):5'- GCTCTTCTCATACTGGAGCATTTG -3'

Sequencing Primer
(F):5'- GAGCTTACATCTTTAGGAACGGCC -3'
(R):5'- CTCATACTGGAGCATTTGACTGTATG -3'
Posted On2015-05-14