Incidental Mutation 'R4131:A4gnt'
ID314680
Institutional Source Beutler Lab
Gene Symbol A4gnt
Ensembl Gene ENSMUSG00000037953
Gene Namealpha-1,4-N-acetylglucosaminyltransferase
Synonymsalpha4GnT, LOC333424
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99612502-99622367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99620618 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 277 (D277G)
Ref Sequence ENSEMBL: ENSMUSP00000045629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042553
AA Change: D277G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045629
Gene: ENSMUSG00000037953
AA Change: D277G

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Gly_transf_sug 65 188 4e-26 PFAM
Pfam:Gb3_synth 197 324 2.5e-49 PFAM
Meta Mutation Damage Score 0.1902 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a protein from the glycosyltransferase 32 family. The encoded enzyme catalyzes the transfer of N-acetylglucosamine to alpha-1,4-linked beta-galactose residues. This enzyme is required for type III mucin synthesis and it is largely associated with the Golgi apparatus membrane. The encoded protein appears to be expressed in adenocarcinoma cells of pancreatic, biliary tract and gastric cancers.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit gastric adenocarcinoma with increased cell proliferation, angiogenesis, inflammation and gastric mucosal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in A4gnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:A4gnt APN 9 99620436 nonsense probably null
IGL01509:A4gnt APN 9 99613766 missense probably benign 0.01
IGL02335:A4gnt APN 9 99620213 missense probably benign
IGL03339:A4gnt APN 9 99620548 missense probably damaging 1.00
PIT4466001:A4gnt UTSW 9 99620560 missense probably damaging 0.99
PIT4472001:A4gnt UTSW 9 99620560 missense probably damaging 0.99
R2027:A4gnt UTSW 9 99620201 missense possibly damaging 0.50
R2061:A4gnt UTSW 9 99620359 missense probably damaging 1.00
R4130:A4gnt UTSW 9 99620618 missense possibly damaging 0.81
R5249:A4gnt UTSW 9 99620231 missense probably damaging 0.99
R5338:A4gnt UTSW 9 99620544 missense probably damaging 1.00
R5672:A4gnt UTSW 9 99620330 missense possibly damaging 0.95
R5785:A4gnt UTSW 9 99620672 missense probably damaging 1.00
R6519:A4gnt UTSW 9 99613670 missense probably damaging 1.00
R6630:A4gnt UTSW 9 99613918 missense probably benign 0.00
R7296:A4gnt UTSW 9 99620282 missense probably damaging 0.97
R7514:A4gnt UTSW 9 99620545 missense probably benign 0.05
R7731:A4gnt UTSW 9 99620417 missense possibly damaging 0.63
Z1088:A4gnt UTSW 9 99613841 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACTATGACTCAACCATTTGGGG -3'
(R):5'- CAGTAGCAACATCTCTCTACCTGG -3'

Sequencing Primer
(F):5'- GCAACCAAGGTCCCCAGTTG -3'
(R):5'- TACCTGGAACCTGTGCCTG -3'
Posted On2015-05-14