Incidental Mutation 'R4131:Heca'
ID314682
Institutional Source Beutler Lab
Gene Symbol Heca
Ensembl Gene ENSMUSG00000039879
Gene Namehdc homolog, cell cycle regulator
SynonymsLOC380629
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location17868612-17948067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17902239 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 537 (S537P)
Ref Sequence ENSEMBL: ENSMUSP00000040707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037879]
Predicted Effect probably damaging
Transcript: ENSMUST00000037879
AA Change: S537P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040707
Gene: ENSMUSG00000039879
AA Change: S537P

DomainStartEndE-ValueType
SCOP:d1gkub1 29 61 8e-3 SMART
Pfam:HECA 94 192 2.8e-42 PFAM
Pfam:Headcase 335 535 2.8e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218758
Meta Mutation Damage Score 0.1342 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila headcase protein, a highly basic, cytoplasmic protein that regulates the re-entry of imaginal cells into the mitotic cycle during adult morphogenesis. In Drosophila, the encoded protein also inhibits terminal branching of neighboring cells during tracheal development. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Igha C A 12: 113,258,829 probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Heca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Heca APN 10 17915967 missense probably damaging 1.00
IGL01971:Heca APN 10 17915414 missense probably damaging 1.00
E0374:Heca UTSW 10 17908176 missense probably damaging 1.00
R0089:Heca UTSW 10 17908100 missense probably damaging 0.99
R0218:Heca UTSW 10 17915715 missense probably benign 0.22
R0608:Heca UTSW 10 17915291 missense possibly damaging 0.86
R4132:Heca UTSW 10 17902239 missense probably damaging 1.00
R4674:Heca UTSW 10 17915309 missense probably benign 0.30
R4675:Heca UTSW 10 17915309 missense probably benign 0.30
R4736:Heca UTSW 10 17915187 nonsense probably null
R4789:Heca UTSW 10 17908147 nonsense probably null
R4819:Heca UTSW 10 17908072 missense probably damaging 1.00
R5372:Heca UTSW 10 17915139 missense probably damaging 1.00
R5412:Heca UTSW 10 17902296 missense probably damaging 1.00
R5737:Heca UTSW 10 17915714 missense possibly damaging 0.76
R6321:Heca UTSW 10 17915243 splice site probably null
R6630:Heca UTSW 10 17908108 nonsense probably null
R7100:Heca UTSW 10 17915373 missense probably benign 0.00
R7381:Heca UTSW 10 17915524 nonsense probably null
R7664:Heca UTSW 10 17902370 missense probably damaging 1.00
R8293:Heca UTSW 10 17902263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTCCCCATTTTAGTGGC -3'
(R):5'- TCAGTCAGTTCCCAGCATTTTG -3'

Sequencing Primer
(F):5'- CCCCATTTTAGTGGCACAAATATAC -3'
(R):5'- CAGTTCCCAGCATTTTGATTAGG -3'
Posted On2015-05-14