Incidental Mutation 'R4131:Igha'
ID314686
Institutional Source Beutler Lab
Gene Symbol Igha
Ensembl Gene ENSMUSG00000095079
Gene Nameimmunoglobulin heavy constant alpha
SynonymsIgA, Igh-2
MMRRC Submission 040994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4131 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113254830-113260236 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) C to A at 113258829 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect unknown
Transcript: ENSMUST00000178282
AA Change: G324V
Predicted Effect probably benign
Transcript: ENSMUST00000194738
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous null mice have no detectable levels of IgA, decreased levels of IgG3, and increased levels of most other classes of immunoglobulins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A G 9: 99,620,618 D277G possibly damaging Het
Abca12 A G 1: 71,319,871 probably null Het
Adam12 C T 7: 133,912,924 V345I probably damaging Het
Arpp21 T A 9: 112,155,308 probably benign Het
Art3 A T 5: 92,392,562 M55L probably benign Het
C1d C T 11: 17,264,054 probably benign Het
Ces1c A G 8: 93,100,684 M484T probably damaging Het
Cisd3 T C 11: 97,688,431 V133A possibly damaging Het
Clpx A G 9: 65,316,655 I230V possibly damaging Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Klk1b3 T A 7: 44,201,687 N181K probably damaging Het
Klra2 T A 6: 131,228,217 R220S probably benign Het
Lama2 C T 10: 27,041,174 V2252I probably benign Het
Megf10 G A 18: 57,180,535 C17Y probably damaging Het
Nup35 G A 2: 80,656,099 probably benign Het
Olfr503 C G 7: 108,544,537 S2* probably null Het
Olfr884 T A 9: 38,047,874 Y217* probably null Het
Pdzd9 A T 7: 120,662,869 D123E possibly damaging Het
Phactr1 A T 13: 43,037,477 Q141L probably damaging Het
Prelid2 T G 18: 41,951,159 D6A possibly damaging Het
Psmd1 T C 1: 86,078,700 S263P probably damaging Het
Rassf6 C T 5: 90,609,787 D105N probably damaging Het
Ryr3 C T 2: 112,926,983 probably null Het
Sema4g T A 19: 44,998,919 F501L probably benign Het
Ssrp1 A G 2: 85,044,447 E537G probably null Het
Try4 T A 6: 41,305,401 Y218* probably null Het
Zbtb40 G T 4: 136,995,396 S790R probably benign Het
Other mutations in Igha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03014:Igha UTSW 12 113259093 missense unknown
R0078:Igha UTSW 12 113259927 splice site probably benign
R3973:Igha UTSW 12 113256352 unclassified probably benign
R4866:Igha UTSW 12 113259509 missense probably benign 0.30
R5931:Igha UTSW 12 113260090 missense probably benign 0.05
R6101:Igha UTSW 12 113256397 unclassified probably benign
R7735:Igha UTSW 12 113256399 critical splice acceptor site probably benign
R8172:Igha UTSW 12 113259972 missense
Predicted Primers PCR Primer
(F):5'- AGTCTCCGAGGCCTTACAAG -3'
(R):5'- AGTGTTTGAGCCCCTAAAGG -3'

Sequencing Primer
(F):5'- TCCGAGGCCTTACAAGCTTAG -3'
(R):5'- TTTGAGCCCCTAAAGGAGCCAG -3'
Posted On2015-05-14